Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen doc

Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen Ghislaine Behar 1,2, *, Patrick Chames 1,2, , Isabelle Teulon 2,3 , Ame ´ lie Cornillon 1,2 , Faisal Alshoukr 2,4,5 , Franc¸oise Roquet 2,6 , Martine Pugnie ` re 2,6 , Jean-Luc Teillaud 2,7,8,9 , Anne Gruaz-Guyon 2,4,5 , Andre ´ Pe ` legrin 2,3 and Daniel Baty 1,2,  1 CNRS, Laboratoire d’Inge ´ nierie des Syste ` mes Macromole ´ culaires, Marseille, France 2 CNRS, Groupement de Recherche Immunociblage des Tumeurs, Marseille, France 3 INSERM, Centre de Recherche en cance ´ rologie de Montpellier, Universite ´ Montpellier, France 4 INSERM, Centre de Recherche Biome ´ dicale Bichat-Beaujon, Paris, France 5 Universite ´ Denis Diderot-Paris 7, France 6 CNRS, Universite ´ Montpellier 1, France 7 INSERM, Centre de Recherche des Cordeliers, Paris, France 8 Universite ´ Pierre et Marie Curie – Paris 6, France 9 Universite ´ Paris Descartes, France Keywords carcinoembryonic antigen; CEACAM5; nonspecific cross-reacting antigen; phage display; single domain antibodies Correspondence D. Baty, INSERM, U624, Stress Cellulaire, Marseille, France Fax: +33 4 91 82 60 83 Tel: +33 4 91 82 88 33 E-mail: daniel.baty@inserm.fr Present addresses *UMR6204, CNRS, Universite ´ de Nantes, France INSERM, U624, Stress Cellulaire, Marseille, France Database The nucleotide sequences in this study have been submitted to the GenBank database under the accession numbers ABS29543 (C3), ABS29544 (C17), ABS29545 (C25), ABS29546 (C43) and ABS29547 (C44) (Received 18 December 2008, revised 20 April 2009, accepted 15 May 2009) doi:10.1111/j.1742-4658.2009.07101.x Single-domain antibodies (sdAbs), which occur naturally in camelids, are endowed with many characteristics that make them attractive candidates as building blocks to create new antibody-related therapeutic molecules. In this study, we isolated from an immunized llama several high-affinity sdAbs directed against human carcinoembryonic antigen (CEA), a heavily glycosylated tumor-associated molecule expressed in a variety of cancers. These llama sdAbs bind a different epitope from those defined by current murine mAbs, as shown by binding competition experiments using immu- nofluorescence and surface plasmon resonance. Flow cytometry analysis shows that they bind strongly to CEA-positive tumor cells but show no cross-reaction toward nonspecific cross-reacting antigen, a highly CEA- related molecule expressed on human granulocytes. When injected into mice xenografted with a human CEA-positive tumor, up to 2% of the injected dose of one of these sdAbs was found in the tumor, despite rapid clearance of this 15 kDa protein, demonstrating its high potential as a targeting moiety. The single-domain nature of these new anti-CEA IgG fragments should facilitate the design of new molecules for immunotherapy or diagnosis of CEA-positive tumors. Structured digital abstract l MINT-7042030: C3 (genbank_protein_gi:152143600) binds (MI:0407)toCEA (uniprotkb: P06731)bysurface plasmon resonance (MI:0107) l MINT-7045726: C17 (genbank_protein_gi:152143602) binds (MI:0407)toCEA (uniprotkb: P06731)bysurface plasmon resonance (MI:0107) l MINT-7046422: C25 (genbank_protein_gi:152143604) binds (MI:0407)toCEA (uniprotkb: P06731)bysurface plasmon resonance (MI:0107) Abbreviations CDR, complementarity determining region; CEA, carcinoembryonic antigen; FITC-GAM, fluorescein isothiocyanate goat anti-mouse Ig; NCA, nonspecific cross-reacting antigen; sCEA, soluble carcinoembryonic antigen; sdAb, single-domain antibody; SPR, surface plasmon resonance. FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3881 Introduction Cancer immunotherapy, either active, i.e. based on the stimulation of specific anti-tumor responses with tumor-associated antigens ⁄ peptides as the immunizing materials, or passive, i.e. based on the injection of mAbs, is now delivering an increasing amount of encouraging data. Notably, several mAbs have been approved for therapeutic use over the last decade. Antibody engineering makes it possible to design new molecules capable of increasing the efficiency of anti- body-based therapies. Since the discovery that func- tional heavy-chain gamma-immunoglobulins lacking light chains occur naturally in the Camelidae [1], sev- eral groups have reported the isolation of single- domain antibodies (sdAbs) consisting of the variable domain of these heavy chain antibodies, also named VHH [2]. These minimal antibody domains are endowed with a large number of properties that make them very attractive for antibody engineering. Despite the reduced size of their antigen-binding surface, VHH domains exhibit affinities similar to those of conventional mAbs and are also capable of binding small molecules as haptens [3,4]. Strikingly, they often use complementarity determining region (CDR) 3 longer than the one of VH domains, which allow them to bind otherwise difficult-to-reach epitopes within the cavities on the antigen surface. Conse- quently, these fragments can recognize epitopes inac- cessible to conventional antibodies and are a good source of enzyme inhibitors [5]. Most importantly, the single-domain nature of VHH permits the amplifica- tion and subsequent straightforward cloning of the corresponding genes, without requiring an artificial linker peptide (as for single-chain Fv fragments) or bi-cistronic constructs (as for Fab fragments). This feature allows direct cloning of large sdAb repertoires from immunized animals, without the need to be con- cerned by the usual disruption of VH ⁄ VL pairing faced when generating scFv and Fab fragment libraries. The sdAb format is also likely responsible for the high production yield obtained when these domains or sdAb-based fusion molecules are expressed. A number of sdAb and sdAb-derived molecules has been produced in large amounts in prokaryotic [6] and eukaryotic [7,8] cell lines, and in plants [9]. Moreover, VHH fragments show exquisite refolding capabilities and amazing physical stability [10]. Last, but not least, the genes encoding VHH show a large degree of homology with the VH3 subset family of human VH genes [11], which might confer low antigenicity in humans, a very attractive feature for immunotherapeutic approaches. Taken together, these data make VHH excellent candidates to engineer multispecific or multifunctional proteins for immunotherapy [12]. Carcinoembryonic antigen (CEA or CEACAM5), a member of the immunoglobulin supergene family, is a heavily glycosylated protein involved in cell adhesion and normally produced by fetal gastrointestinal tis- sues. It was first described by Gold and Freedman in 1965 [13] as a high-molecular mass glycoprotein ( 180 kDa) found in colonic tumors and fetal colon, but not in normal adult colon; its expression has since been described in almost all tumors (> 95%) including rectum, breast, lung, liver, pancreas, stom- ach, thyroid and ovarian tumors. Nonspecific cross- reacting antigen (NCA or CEACAM6) is a highly related member of the same CEACAM family. CEA and NCA polypeptides have extracellular domains, some with cysteine-linked loops, that share extensive amino acid sequence homology ( 78% overall) with each other and appear similar to other immunoglobu- lin superfamily members. A major difference between the two apoproteins is the presence of a single loop- domain in NCA, compared with three tandemly repeated loop-domains in CEA. Comparisons between the extracellular domains of CEA and NCA show that the N-terminal and adjacent loop-domains of each apoprotein have high sequence homology (85– 90%). Consequently, many mAbs raised against CEA also bind with high affinity to NCA. CEA has been extensively chosen as the target for directed cancer therapies aimed at selectively destroying cells express- ing this tumor antigen but sparing normal cells. Based on a large body of evidence indicating that CEA is associated with the growth and metastasis of cancers [14], this tumor marker represents an interest- ing model target with which to monitor the efficacy of sdAb-based multifunctional molecules. As a first step towards the generation of new CEA- targeted therapeutic molecules, we generated a panel l MINT-7046473: C43 (genbank_protein_gi:152143606) binds (MI:0407)toCEA (uniprotkb: P06731)bysurface plasmon resonance (MI:0107) l MINT-7046442: C44 (genbank_protein_gi:152143608) binds (MI:0407)toCEA (uniprotkb: P06731)bysurface plasmon resonance (MI:0107) CEA-specific single domain antibodies G. Behar et al. 3882 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS of llama-derived sdAbs capable of binding with high affinity to CEA. Importantly, we were able to select CEA-specific sdAbs showing no cross-reaction with NCA that is expressed on several normal cell types, including granulocytes. Moreover, these sdAbs do not bind to known epitopes recognized by monoclonal murine anti-CEA IgGs. Thus, these sdAbs represent versatile tools to generate potent antibody-based molecules for cancer therapy. Results Isolation of sdAbs against CEA A male llama was immunized subcutaneously five times with 250 lg recombinant purified soluble CEA (sCEA) per injection. A library of 10 6 clones was obtained by RT-PCR amplification and cloning of VHH genes, using RNA purified from llama peripheral blood cells. A clas- sic issue with anti-CEA IgGs is their high tendency to cross-react with the highly related NCA receptor. To increase the chance of selecting a diverse panel of sdAbs against CEA, two antigen immobilization methods were used. Recombinant human sCEA was either directly immobilized by adsorption onto plastic (immunotubes) (Method A), or indirectly immobilized on magnetic beads via a biotin ⁄ streptavidin system (Method B) (see Material and Methods). After one round of affinity selection, 48 clones ran- domly picked from each output were assayed by phage-ELISA for binding to biotinylated sCEA immobilized on streptavidin plates. All clones picked from the output of Method A were positive, whereas only 61% from Method B were positive. Conse- quently, two more rounds were performed for Method B, which ultimately led to 100% of binders by phage ELISA. Sequence analysis of the 48 clones picked from Method A (round 1) revealed that three highly related antibodies, displaying identical residues in their CDRs, dominated the population. Sequence analysis of the 48 clones picked at random from method B (rounds 1–3) revealed that the output included five sdAbs, namely C3, C17, C25, C43 and C44. C44 was the clone domi- nating the output of Method A. Interestingly, the amino acid alignment (Fig.1) showed that sdAbs C3, C17, C25 and C43 are likely clonally related, despite the presence of a relatively high number of differences scattered all along the gene. CDR3 of C3, C25 and C43 are very similar, suggesting use of the same D gene. C17 shows very similar CDR1 and CDR2, but a rather different CDR3. Interestingly, CDR1 and CDR3 of clone C44 are totally unrelated to CDR1 and CDR3 of the other sdAbs. In all cases, the presence of an arginine at position 50 (Fig. 1) con- firmed the Camelidae nature of these sdAbs. All of them belong to subfamily VHH2 [15]. Affinity determination by surface plasmon resonance To further characterize these sdAbs, the corresponding cDNA were cloned into the expression vector pPelB55- PhoA’ [16], allowing efficient production and purifica- tion of the molecules. SdAbs harboring a hexahistidine tag at the C-terminus were produced in the periplasm of Escherichia coli and purified by immobilized ion metal-affinity chromatography. Final yields were in the range 5–10 mgÆL culture )1 for all clones. SDS ⁄ PAGE analysis demonstrated a satisfying degree of purity (> 95%, data not shown). Pure sdAbs were then indi- rectly immobilized on BIAcore sensorchips and their affinity for soluble CEA determined. As shown in Table 1, all sdAbs exhibited a good affinity for sCEA, with a K D ranging from 3 to 32 nm. Specificity analysis by flow cytometry Flow cytometry was used to determine whether the selected sdAbs specifically bind to CEA + , but not Fig. 1. Amino acid sequences of CEA-specific sdAbs. The IMGT numbering [33] is shown. The localization of frameworks (FR1 to FR4) and CDRs are indicated. Dashes indicate sequence identity. G. Behar et al. CEA-specific single domain antibodies FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3883 CEA ) , cells and to examine if any cross-reaction with NCA could be detected. sdAbs were assayed by flow cytometry for binding to colon cancer MC38 cells (CEA ) NCA ) ), or to transfected MC38 cells expressing either CEA or NCA (kindly provided by F.J. Primus, Vanderbilt University Medical Center, Nashville, TN, USA). Cells from the CEA + colon cancer cell line LS174T, as well as from freshly purified human granulocytes that display NCA but not CEA, were also tested. Fig. 2. Flow cytometry analysis of sdAb C17 and C44 binding to MC38 cells expressing CEA or NCA. Purified sdAbs were incubated with colon cancer MC38 cells (negative control), with transfected CEA + or NCA + MC38 cells, with CEA + colon cancer LS174T cells or with freshly purified human granulocytes that express NCA but not CEA. Bound sdAbs were detected with a monoclonal anti-c-myc IgG followed by FITC-labeled F(ab¢) 2 goat anti-mouse IgG (H+L). Mouse mAbs 35A7 (CEA specific) and 192 (binding to an epitope common to CEA and NCA) were used as controls. C3, C25 and C43 sdAb profiles (not shown) were identical to those of sdAb C17, demonstrating binding to CEA but not NCA, in contrast to sdAb C44, which binds to both molecules. x-axis, log of fluorescence intensity; y-axis, number of events. Table 1. Kinetic and affinity constants of the binding of soluble carcinoembryonic antigen (sCEA) to CEA-specific sdAbs immobilized via monoclonal anti-(c-myc) 9E10 on CM5 microchips. A Langmuir 1 : 1 model was used to fit six different sCEA concentrations. No binding of sCEA on immobilized 9E10, mass transport or rebinding effect was observed. v 2 , statistical value for describing the closeness of the fit. Val- ues of v 2 < 10% of the R max are usually acceptable. RU, relative units. Single-domain antibody k a · 10 5 (1ÆMs )1 ) k d · 10 )3 (1Æs )1 ) K D (nM) R max (RU) v 2 C44 8.21 ± 0.040 2.64 ± 0.004 3.20 236 3.00 C43 1.78 ± 0.019 1.83 ± 0.002 10.30 284 0.55 C25 1.13 ± 0.014 3.60 ± 0.004 31.7 292 0.30 C17 1.56 ± 0.014 1.30 ± 0.002 8.30 254 0.22 C3 1.24 ± 0.014 1.68 ± 0.002 13.6 254 0.30 CEA-specific single domain antibodies G. Behar et al. 3884 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS Figure 2 shows that C17 sdAb efficiently binds to CEA-expressing cells (MC38–CEA + and LS174T) but not to NCA + human granulocytes. C3, C25 and C43 sdAb binding profiles were identical to that of C17 sdAb (data not shown). By contrast, sdAb C44 was also capable of binding to MC38–NCA + cells and to human granulocytes, whereas all other sdAbs did not show any binding to these cells. C44 sdAb is therefore recognizing an epitope shared by CEA and NCA, in contrast to C3, C17, C25 and C43, which are strictly specific for CEA. Monoclonal antibodies that either bind both CEA and NCA (mAb 192) or only CEA (mAb 35A7) were used as controls (Fig. 2). Competitive inhibition of antibody binding to LS174T cells To further characterize the binding properties of sdAbs C3, C17, C25, C43 and to investigate whether different CEA epitopes were recognized by these antibodies, binding competition experiments were performed using cells from the CEA-expressing cell line LS174T. Cells were incubated with trace amounts of 125 I-labeled sdAb C17 (0.4 nm) in the presence of increasing con- centrations of unlabeled sdAbs. As shown in Fig.3, sdAbs C25, C3 and C43 were able to compete with C17, indicating that these sdAbs bind to overlapping epitopes or to the same epitope. Moreover, sdAb IC 50 is in the nm range for three of the four sdAbs (C3, 1.6 ± 0.4 nm; C17, 7.8 ± 1.3 nm; C43, 5.2 ± 0.3 nm). Only sdAb C25 exhibits a significantly lower apparent affinity (59.1 ± 0.6 nm). These values obtained from cell-binding experiments are in good agreement with surface plasmon resonance (SPR) data (Table 1), except for sdAb C3 (K D = 13.6 nm). This difference might be because of a different conformation and ⁄ or glycosylation of the sdAb epitope on cell-displayed CEA and on recombinant sCEA immobilized on sensor chips. Epitope analysis by surface plasmon resonance Most CEA-specific mAbs available to date can be clas- sified into five categories (Gold 1-5) according to their epitope [17]. To determine if one or more of these epi- topes was recognized by the CEA-specific sdAbs (C3, C17, C25, C43), a qualitative SPR-based sandwich assay was used. sdAbs were first captured via their c-myc tag on the CM5 sensorchip surface coated with the monoclonal anti-c-myc IgG 9E10 to favor a good exposition of the captured sdAbs. Recombinant sCEA was then injected and captured by the sdAbs. Subse- quently, one of the five Gold mAbs recognizing one of the five Gold epitopes was injected. Under these condi- tions, binding of the Gold mAb indicates that its cor- responding epitope is not blocked by the capturing sdAb. All Gold mAbs were tested against all CEA- specific sdAbs. Sensorgrams obtained with sdAb C17 are shown in Fig. 4A. All sdAb and Gold mAb combi- nations led to efficient binding of Gold mAb to the captured sCEA, demonstrating that none of the five Gold epitopes is recognized by the CEA-specific sdAbs. All five anti-CEA Gold IgGs were able to bind captured sCEA, whereas an irrelevant mAb (mouse anti FccRIII) did not. As a positive of competition, a version of the sdAb used for CEA capture but devoid of the c-myc tag was injected instead of Gold mAbs. No increase in signal was obtained, showing that com- petition can be efficiently demonstrated between these molecules in our assay. An irrelevant sdAb [anti-(HIV- 1 NEF) devoid of c-myc tag] injected at the same concentration was used as a negative control. Moreover, in a reverse scheme, all sdAbs were able to bind to recombinant sCEA captured on the chip via Gold mAbs covalently immobilized on CM5 sensor- chip. Figure 4B shows the results obtained with the mAb 35A7 as an example. Epitope analysis by flow cytometry The absence of competition between gold mAbs and sdAbs was confirmed using nonrecombinant cell- Fig. 3. Competitive inhibition of antibody binding to LS174T cells. Competition between 125 I-labeled sdAb C17 (0.4 nM) and increasing amounts of unlabeled sdAb C17 (square), sdAb C25 (triangle), sdAb C3 (circle) and sdAb C43 (diamond) for binding on LS174T cells (5 · 10 6 cellsÆmL )1 ). Each point is the mean of triplicate determina- tions of a representative experiment ± SEM, unless smaller than the point as plotted. Nonspecific binding was evaluated in the pres- ence of an excess of unlabeled sdAb C17 (2 · 10 )7 M). G. Behar et al. CEA-specific single domain antibodies FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3885 surface displayed CEA by flow cytometry. CEA- expressing cells were first incubated with very high concentrations (up to 2190 nm) of sdAb C17 devoid of the c-myc tag. After 1 h of incubation, subsaturating concentrations of either gold mAbs or c-myc-tagged sdAb C17 or C43 (30-70 nm as determined in a previ- ous flow cytometry experiment, data not shown) were added to the wells. After an additional 1 h of incuba- tion, bound gold mAbs and c-myc-tagged sdAbs were revealed. As shown in Fig. 5, the presence of a large excess (more than two orders of magnitude) of untag- ged sdAb C17 did not interfere with the binding of gold mAbs, but completely inhibited the binding of c-myc-tagged sdAb C17 or sdAb C43 that bind to the same epitope (see above). These results confirmed that these sdAbs do not bind to any of the epitopes recog- nized by gold mAbs. In vivo localization To analyze the behavior of sdAbs against CEA under more physiological conditions, immunocompromised mice were xenografted with LS174T cancer cells. Once tumors were established (i.e., day 7), radiolabeled sdAb C17 (displaying the highest affinity as measured by SPR) was injected and the biodistribution was monitored. A fast blood clearance was observed, as assessed by the low residual blood radioactivity 6 h after injection [0.30 ± 0.06% of the injected dose per gram % IDÆg )1 ± SEM)]. Activity uptake was observed pri- marily in kidneys (7.4 ± 0.4% IDÆg )1 3 h post injec- tion and 4.8 ± 0.6% IDÆg )1 at 6 h post injection). Three hours after injection, 1.9 ± 0.1% of the injected dose was localized in the tumor. This was at least two- fold higher than the radioactivity found in blood, liver and major organs except kidneys, and was 3.5- and 5-fold higher than the radioactivity found in bones and leg muscles, respectively (Fig. 6). Six hours after injection, the increased clearance resulted in higher tumor-to-normal tissue uptake ratios for all these organs, reaching a ratio of 10 in the case of muscles. Discussion As a first step toward the construction of multispeci- fic and ⁄ or multivalent molecules aiming at redirecting immune cells such as T cells or NK cells to tumor cells, we isolated sdAbs able to bind to CEA (or CEACAM5), a tumor marker used in cancer diagno- sis and immunotherapy. We used phage display to select binders from one sdAb library derived from peripheral blood mononuclear cells isolated from an immunized llama. Interestingly, two selection methods led to strikingly different outputs. Selection by panning on recombinant sCEA directly adsorbed on plastic allowed the isolation of a single family of highly related sdAbs that dominated the selected pop- ulation only after a single round of selection. How- Fig. 4. Epitope analysis by surface plasmon resonance (BIAcore). (A) c-myc-tagged sdAbs were captured on an anti-c-myc IgG-coated CM5 chip. sCEA was injected (curves a) or not (curves b), followed by injection of one of the Gold mAbs. The dissociation of sdAbs from 9E10 was corrected by subtraction of a control flow cell coated with 9E10 and injected with sdAbs only. Sensorgrams obtained with sdAb C17 are shown as an example. Irr mAb, irrele- vant mAb (mouse anti-FccRIII). As a positive control of competition, sdAb C17 devoid of the c-myc tag was injected after CEA capture. The absence of binding demonstrates that the epitope of this sdAb was efficiently blocked by the binding of the immobilized sdAb. An irrelevant sdAb (anti HIV-1 NEF) injected at the same concentration was used as a negative control (irr sdAb). (B) sCEA (curves a) or buffer (curves b) were injected on Gold mAb-coated CM5 chips, followed by an injection of different sdAbs. CEA-specific single domain antibodies G. Behar et al. 3886 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS ever, the epitope recognized by these antibodies is also present on a highly related molecule, nonspecific cross-reacting antigen (NCA or CEACAM6) that shares the same Ig domain-based structure with CEA and displays a high percentage of sequence homology. By contrast, a selection based on biotinylated sCEA captured on streptavidin-coated magnetic beads led to only 61% binders after a single round and two more rounds of selection were needed to reach 100% bind- ers. Unlike the first method, the output of this selec- tion was more diverse. This method yielded antibodies belonging to the family selected by pan- ning on coated sCEA, but also made it possible to isolate several other clones displaying very similar CDR1 and CDR2, but more diverse CDR3, suggest- ing use of the same VHH gene but different D genes. Flow cytometry analyses demonstrated that these sdAbs bind specifically to CEA expressed on cancer cells but do not cross-react with NCA. These anti- bodies were not present in the output of the panning method, despite very similar affinities for the antigen, in the nm range, as determined by SPR. One can hypothesize that the conformational changes resulting from the adsorption of CEA on plastic are either denaturing the epitope recognized by the second family of sdAbs or are favoring the display of the epitope recognized by the first family, leading to a large presence of this latter family during the selec- tion process. As expected for llama VHHs, the sequences of the CEA-specific sdAbs are homologous to human IGHV3 subgroup genes (C3, 79% homology to IGHV3-23; C17, 68% homology to IGHV3-74; C25, 69% homol- ogy to IGHV3-48; C43, 69% homology to IGHV3-13). The most divergent sequences between the four llama sdAbs and human IGHV3 are localized in the CDRs, Fig. 5. Epitope analysis by flow cytometry. CEA-expressing cells were preincubated with a large excess of untagged sdAb C17 (competitor). Subsaturating concentrations (30–70 n M) of Gold mAbs or c-myc tagged C17 and C43 were then added to the mix. After washing, bound Gold mAbs or c-myc tagged sdAbs were detected by flow cytometry. Solid black histograms, isotype control. Solid gray histograms indicate the absence of competitor. Black lines indicate the presence of competitor. G. Behar et al. CEA-specific single domain antibodies FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3887 and in the former VL and CH1 interfaces (residues 40, 42, 49, 50 and residues 15 and 96, respectively). More- over, the selected llama sdAbs belong to subfamily VHH2 [15]. As described earlier for VHH belonging to this family, CDR3 from these four sdAbs do not con- tain an additional disulfide bond and do not exceed the mean CDR3 length of classical VH, in contrast to most camel VHH [18]. Of note is that that none of these antibodies binds to one of the Gold epitopes. These essentially nonover- lapping epitopes have been defined by analyzing the binding specificities of 52 monoclonal anti-CEA IgGs and define five antigenic regions recognized by murine mAbs [17]. In this study, the only four mAbs not bind- ing to these five regions were directed against carbo- hydrate epitopes, suggesting that the rest of the CEA surface does not elicit antibodies. Epitope analysis performed on recombinant sCEA using SPR or on the surface of living cells demonstrated that the sdAbs target overlapping epitopes and might even share a unique epitope, because it could be anticipated by the high degree of homology of their CDRs. Interestingly, this is not one of the Gold epitopes because no compe- tition was observed between Gold mAbs and the sdAbs, as demonstrated both by SPR on soluble CEA and flow cytometry experiments on cell-displayed CEA. This new epitope, not found on NCA, is there- fore not easily detected by murine mAbs. This finding supports a previous study showing that sdAbs have a tendency to bind to epitopes usually invisible to other mAbs, such as cavities, and are a rich source of enzyme inhibitors [19]. In the case of CEA, a heavily glycosylated molecule, one can also hypothesize that the oligosaccharide chains can hinder the access of some regions of the polypeptide to large molecules such as mAbs (150 kDa) but not to very compact sdAb (13 kDa). However, it should be reminded that the sdAbs were selected as phage–sdAbs, which implies that the large phage particle did not prevent binding of the sdAbs to this epitope. IC 50 values calculated from cell-surface competition experiments and K D values measured by SPR are in the nm range for sdAbs C17, C3 and C43, demonstrat- ing that these sdAbs, selected against a recombinant ectodomain of CEA can efficiently bind their antigen when displayed at the cell surface of human tumor cells. The high affinities of the selected sdAbs, which compares favorably with conventional mAbs despite their monovalency, should allow an efficient in vivo targeting of tumor cells expressing CEA. To verify this hypothesis, we conducted an in vivo localization experi- ment in LS174T-xenografted nude mice with sdAb C17, which binds to CEA with the highest affinity as measured by SPR. Blood clearance of this sdAb was fast because low blood radioactivity was observed as early as 6 h after injection. This result is in agreement with the sdAb blood half-life that has been estimated to be 20–40 min in mice [20,21]. Despite this rapid blood clearance and the monovalent nature of the sdAb excluding an avidity effect, almost 2% of the injected dose accumulates in tumor tissues (fivefold higher than in muscle tissues), which compares well with the results of Cortez-Retamozo et al. [22]. These authors injected LS174T-xenografted mice with a CEA-specific sdAb fused to beta-lactamase and 2.8% of the total injected dose was found in the tumor 6 h after injection, despite a blood half-life expected to be significantly higher for this 45 kDa construct than for sdAb C17 (13 kDa). In this study, 3 h after injection, 7% IDÆg )1 were found in kidneys, which decreased to 5% at 6 h post injection. This renal accumulation is expected for very small molecules such as sdAbs (13-15 kDa). Ultrafiltration of low molecular mass proteins and subsequent uptake by proximal tubular cells followed by lysosomal degradation leads to the intracellular accumulation of radioactivity. It is Fig. 6. Biodistribution of sdAb against CEA C17 injected in xeno- grafted mice. Nude mice subcutaneously xenografted with tumor cells LS174T were injected in the tail vein with 10 pmol of 125 I- labeled sdAb C17. After 3 h (black bars) and 6 h (open bars), mice were anesthetized and killed. Blood, organs and tumor masses were weighed and the radioactivity counted. Results are expressed as the ratio between tumor uptake and organ uptake (mean ± - SEM, n = 3). Injected doses were corrected by subtraction of non- injected and subcutaneously injected material. Bl, blood; Lu, lung; Li, liver; Sp, spleen; Si, small intestine; Co, colon; Ki, kidney; Mu, muscle; Bo, bone. CEA-specific single domain antibodies G. Behar et al. 3888 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS expected that systemic administration of basic amino acids may reduce renal retention of radioiodinated sdAbs because it is efficient in lowering kidney uptake of antibody fragments [22a]. The low activity accre- tion observed in other organs led to tumor-to-organ radioactivity uptake ratios of at least 2 (range 2–5) 3 h after injection and 3 (range 3–9) at 6 h after injection. Overall, sdAb C17 showed an expected biodistribu- tion profile, demonstrating its utility as a CEA + tumor-targeting molecule. In conclusion, the specificity, affinity and single- domain structure of the new CEA-specific sdAbs isolated here make them very attractive candidates to build, together with sdAbs targeting receptors such as CD16 (FccRIII) [23] or other activating receptors or radiolabeled haptens [4], new multivalent and ⁄ or multispecific molecules with superior characteristics for immunotherapy or radioimmunotherapy. Material and methods Llama immunization A young adult male llama (Lama glama) was immunized subcutaneously at days 1, 30, 60, 90 and 120 with 250 lg recombinant human soluble CEA extracellular domain (sCEA) produced as previously described [24]. Sera were collected 15 days prior to each injection to follow the immune response against the immunogen. VHH library construction Blood samples (100 mL) were taken 15 days after each of the three latest immunizations and peripheral blood mononu- clear cells were isolated by Ficoll-Histopaque-1077 (Sigma- Aldrich, St. Louis, MO, USA) discontinuous gradient centrifugation. Total RNA was isolated by acid guanidinium thiocyanate ⁄ phenol ⁄ chloroform extraction [25] and synthesis of the cDNA was performed with Superscript II reverse transcriptase (GibcoBRL, Gaithersburg, MD, USA) using primer CH2FORTA4 [26]. A first PCR was performed using an equimolar mixture of four backward primers originally designed to anneal on human VH genes (5¢ VH1–Sfi: 5¢-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGGTGCAGTCTGG-3¢;5¢ VH2–Sfi: 5¢-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CCAGGTCACCTTGAAGGAGTCTGG-3¢;5¢ VH3–Sfi: 5¢-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CGAGGTGCAGCTGGTGGAGTCTGG-3¢;5¢ VH4–Sfi: 5¢-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CCAGGTGCAGCTGCAGGAGTCGGG-3¢) and one for- ward primer (CH2FORTA4). These primers allow the ampli- fication of two bands corresponding two the VH + CH1 + hinge + part of CH2 gene fragment of traditional antibodies or the VHH + hinge + part of CH2 gene fragment of HcAbs. Using the gel-purified (Qiaquick gel extraction kit; Qiagen, Hilden, Germany) lower band as the template, VHH genes were re-amplified using an equimolar mixture of the four backward primers (5¢ VH1 to 4-Sfi) and 3¢ VHH–Not primer (5¢-CCACGATTCTGCGGCCGCTGAGGAGACR GTGACCTGGGTCC-3¢) containing SfiI and NotI restric- tion enzyme sites. Resulting VHH fragments were purified from 1% agarose gel, digested with SfiI and NotI and ligated into pHEN1 phagemid [27] digested with SfiI and NotI. The ligated material was transformed into TG1 E. coli electro- poration-competent cells (Stratagen, Miami, FL, USA). Cells were plated on 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%) agar plates. Colonies (10 6 ) were scraped from the plates with 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%), and stored at )80 °C in the presence of 20% glycerol. Because llamas were hyperimmunized, a library containing a million of different clone can be considered as representative. Selection of phage–sdAbs Selections were performed as described previously [28]. Briefly, 10 lL of the library was grown in 50 mL of 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%) at 37 ° Cto an D 600 of 0.5. Five milliliters of the culture were then infected with 2 · 10 10 M13KO7 helper phage for 30 min at 37 °C without shaking. The culture was centrifuged for 10 min at 3000 g. The bacterial pellet was resuspended in 25 mL of 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ kanamycine (25 lgÆmL )1 ), and incubated for 16 h at 30 °C with shaking (270 rpm). The culture was then centrifuged for 20 min at 3000 g and one-fifth of the volume of 20% PEG 6000, 2.5 m NaCl was added to the supernatant and incubated for 1 h on ice to precipitate phage particles. The solution was then centrifuged for 15 min at 3000 g at 4°C and the phage-containing pellet was re-suspended with 1 mL of NaCl ⁄ P i . Phage were selected using either immunotubes coated with recombinant sCEA [24] (10 lgÆmL )1 in NaCl ⁄ P i , overnight 4 °C) or biotinylated sCEA and streptavidin-coated para- magnetic beads (Dynabeads M-280; Dynal Biotech, Oslo, Norway). Recombinant sCEA was biotinylated using a bio- tin protein-labeling kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). Two hundreds microliters of beads were mixed with 1 mL NaCl ⁄ P i contain- ing 2% skimmed milk powder (NaCl ⁄ P i ⁄ 2% milk) for 45 min at room temperature in a siliconized Eppendorf tube. Beads were washed with NaCl ⁄ P i ⁄ 2% milk using a magnetic particle concentrator and resuspended with 250 lL NaCl ⁄ P i ⁄ 2% milk. We added 200 lL of biotinylated sCEA and the solution was gently rotated for 30 min at room tem- perature; 150, 75 and 25 nm of biotinylated sCEA were used for the first, second and third rounds of selection, respec- tively. We then added 450 lL of the phage preparation (10 12 pfu), preincubated for 1 h in 500 lL NaCl ⁄ P i ⁄ 2% milk. G. Behar et al. CEA-specific single domain antibodies FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3889 The mixture was rotated for 3 h at room temperature and washed five times with 800 lL NaCl ⁄ P i ⁄ 4% milk, five times with 800 lL NaCl ⁄ P i containing 0.1% Tween and five times with 800 lL NaCl ⁄ P i . Every five washes, the mixture was transferred to a new siliconized tube. Phage fixed on sCEA- coated beads were resuspended with 200 lL NaCl ⁄ P i and incubated without shaking with 1 mL of log-phase TG1 cells and plated on 2YT ⁄ ampicillin (100 l g ÆmL )1 ) ⁄ glucose (2%) in 243 · 243 mm dishes (Nalgene Nunc, Roskilde, Den- mark). Some isolated colonies were grown overnight in mi- crotiter plate containing 200 lL 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%) and stored at )80 °C after the addition of 15% glycerol (masterplates). The remaining colo- nies were harvested from the plates, suspended in 2 mL 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%) and used for phage production for the next round of selection. ELISA screening of phage–sdAb A 96-well plate replicator was used to replicate the mas- terplates in 120 lL of fresh broth. Colonies were grown for 2 h at 37 °C under shaking (400 rpm) and 35 lL 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ glucose (2%) containing 2 · 10 9 M13KO7 helper phage were added to each well and incubated for 30 min at 37 °C without shaking. The plate was centrifuged for 10 min at 1200 g and the bacte- rial pellet was suspended in 150 lL 2YT ⁄ ampicillin (100 lgÆmL )1 ) ⁄ kanamycine (25 lgÆmL )1 ) and grown for 16 h at 30 °C under shaking (400 rpm). Phage-containing supernatants were tested for binding to sCEA by ELISA. Briefly, biotinylated sCEA (5 lgÆ mL )1 ) was coated on streptavidin 96-well microplates (BioBind assembly strepta- vidin coated; Thermo Fischer Scientific, Waltham, MA, USA) saturated with NaCl ⁄ P i ⁄ 2% milk. Fifty microliters of phage supernatant were added to 50 lL NaCl ⁄ P i ⁄ 4% milk and incubated for 2 h at room temperature in the ELISA microplate. Bound phage were detected with a per- oxidase-conjugated monoclonal anti-M13 mouse IgG (GE Healthcare, Munich, Germany). Reading was performed at A 405 . DNA of positive phage (A 405 three times above the blank) was sequenced using abi prismÒ bigdyeÔ Terminators (Applied Biosystems, Foster City, CA, USA). SdAb production and purification Selected clones were sequenced and amplified by PCR using primers 5¢ pJF–VH3–Sfi (CTTTACTATTCTCAC GGCCA TGGCGGCCGAGGTGCAGCTGGTGG) and 3¢ c-myc– 6His ⁄ HindIII (CCGCGCGCGC CAAGACCC AAGCTTG GGCTARTGRTGRTGRTGRTGRTGTGCGGCCCCAT TCAGATC) to add the HindIII site for further cloning, a hexahistidine tag for purification and the c-myc tag for detection. For production of clones without the c-myc tag, the PCR amplification was performed using primers 5¢ pJF–VH3–Sfi and 3¢ 6His ⁄ HindIII (CCGCGCGCGCC AAGACCC AAGCTTGGGCTACTAGCTCCCGTGGTG ATGGTGGTGATGTGAGGAGACAGTGACCTG). PCR fragments were cloned into the pPelB55PhoA¢ [16] vector between the Sfi I and HindIII sites. E. coli K12 strain TG1 was used to produce the sdAb-tagged fragments. An inoculum was grown overnight at 30 °C in 2YT medium sup- plemented with 100 lgÆmL )1 ampicillin and 2% glucose. Four hundred milliliters of fresh medium were inoculated to obtain an D 600 of 0.1, and bacteria were grown at 30 °Cto an D 600 of 0.5–0.7 and induced with 100 lm isopropyl thio-b- d-galactoside for 16 h. The cells were harvested by centrifu- gation at 4200 g for 10 min at 4 ° C. The cell pellet was suspended in 4 mL of cold TES buffer (0.2 m Tris ⁄ HCl, pH 8.0; 0.5 mm EDTA; 0.5 m sucrose), and 160 lL lysozyme (10 mgÆmL )1 in TES buffer) was added. The cells were then subjected to osmotic shock by the addition of 16 mL of cold TES diluted 1 : 2 with cold H 2 O. After incubation for 30 min on ice, the suspension was centrifuged at 4200 g for 40 min at 4 °C. The supernatant was incubated with 150 lL DNase I (10 mgÆmL )1 ) and MgCl 2 (5 mm final) for 30 min at room temperature. The solution was dialyzed against 50 mm sodium acetate pH 7.0, 0.1 m NaCl, for 16 h at 4 °C. sdAbs were purified by TALON metal-affinity chromatography (Clontech, Mountain View, CA, USA) and concentrated by ultrafiltration with Amicon Ultra 5000 MWCO (Millipore, Billerica, MA, USA). The protein concentration was deter- mined spectrophotometrically using a protein assay kit (Bio- Rad Laboratories, Hercules, CA, USA). Affinity measurements Kinetic parameters were determined by real-time SPR using a BIACORE 3000 apparatus. Monoclonal anti-c- myc IgG 9E10 was covalently immobilized (3300 RU) on a flow cell of CM5 sensor chip (Biacore AB, Uppsala, Sweden) with EDC ⁄ NHS activation according to the manufacturer’s instructions. A control flow cell surface was prepared with the same treatment but without anti- body. All analyses were performed at 25 °C, at a flow rate of 30 lgÆmL )1 and using HBS-EP (Biacore AB; 10 mm Hepes pH 7.4, 150 mm NaCl, 3.4 mm EDTA and 0.005% BiacoreÔ surfactant) as running buffer. Each sdAb was injected (90 lL) at a concentration of 50 lgÆmL )1 in HBS-EP over 3 min and followed by a 90 lL injection of sCEA at six different concentrations (0.19–6.2 lgÆmL )1 ). A 400 s dissociation step was applied before a pulse of 5 mm HCl to regenerate the flow cell surfaces between each run. The absence of direct sCEA binding to 9E10 was assessed. The control sensorgram obtained by injection of sdAb only on the 9E10 flow cell was subtracted from all other sensorgrams to compensate for sdAb dissociation from 9E10 mAb. Resulting senso- grams were fitted to a Langmuir 1 : 1 binding isotherm model and errors on k a and k d were calculated using biaevaluation 3.2 software. CEA-specific single domain antibodies G. Behar et al. 3890 FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... Pelegrin A (1993) Marked increase in the secretion of a fully antigenic recombinant carcinoembryonic antigen obtained by deletion of its hydrophobic tail Mol Immunol 30, 921–927 25 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction Anal Biochem 162, 156–159 CEA-specific single domain antibodies 26 Arbabi Ghahroudi M, Desmyter A,... Freedman SO (1965) Specific carcinoembryonic antigens of the human digestive system J Exp Med 122, 467–481 Hammarstrom S (1999) The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues Semin Cancer Biol 9, 67–81 Harmsen MM, Ruuls RC, Nijman IJ, Niewold TA, Frenken LG & de Geus B (2000) Llama heavy-chain V regions consist of at least four distinct... the process was repeated to test the ability of each Gold mAb to bind sCEA once this molecule had been bound to a given sdAb The absence of binding of the different Gold mAbs to the 9E10 mAb alone or to the sdAbs in absence of sCEA, as well as the absence of binding of an irrelevant antibody to the captured sCEA (mouse antiFccRIII) was verified The absence of competition between the sdAbs and Gold mAbs... Hermans P, Frenken L et al (2006) Lactobacilli expressing variable domain of llama heavy-chain antibody fragments (lactobodies) confer protection against rotavirus-induced diarrhea J Infect Dis 194, 1580–1588 7 Frenken LG, van der Linden RH, Hermans PW, Bos JW, Ruuls RC, de Geus B & Verrips CT (2000) Isolation of antigen specific llama VHH antibody fragments and their high level secretion by Saccharomyces... After 2.5 h under shaking, 100 lL of the suspensions were centrifuged in triplicate for 30 s through a phthalate mixture [32] An aliquot of supernatant and the cell pellet from each tube were counted (three experiments, each in triplicate) The non-specific binding was evaluated in the presence of an excess of unlabelled sdAb C17 (2 · 10)7 m) CEA-specific single domain antibodies IC50 values and statistics... by subtraction of non-injected and subcutaneously injected material FEBS Journal 276 (2009) 3881–3893 ª 2009 The Authors Journal compilation ª 2009 FEBS 3891 CEA-specific single domain antibodies G Behar et al (remaining in the animal tail) from the total dose All studies were performed with groups of three mice Results were expressed as the mean percentage of injected dose per gram of tissue ± SEM... identification of single domain antibody fragments from camel heavy-chain antibodies FEBS Lett 414, 521–526 27 Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P & Winter G (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains Nucleic Acids Res 19, 4133–4137 28 Chames P, Hoogenboom HR & Henderikx P (2002) Selection of antibodies. .. antibodies against biotinylated antigens Methods Mol Biol 178, 147–157 29 Mizobata S, Tompkins K, Simpson JF, Shyr Y & Primus FJ (2000) Induction of cytotoxic T cells and their antitumor activity in mice transgenic for carcinoembryonic antigen Cancer Immunol Immunother 49, 285–295 30 Vely F, Gruel N, Moncuit J, Cochet O, Rouard H, Dare S, Galon J, Sautes C, Fridman WH & Teillaud JL (1997) A new set of monoclonal... (1998) Reducing the renal uptake of radiolabeled antibody fragments and peptides for diagnosis and therapy: present status, future prospects and limitations Eur J Nucl Med 25, 201–212 23 Behar G, Siberil S, Groulet A, Chames P, Pugniere M, Boix C, Sautes-Fridman C, Teillaud JL & Baty D (2008) Isolation and characterization of anti-Fc{gamma}RIII (CD16) llama single-domain antibodies that activate natural... performed on cells from the LS174T colon carcinoma cell line (ATCC) We incubated 150 lL of 125I-labeled sdAb C17 (4 · 10)10 m final concentration, specific activity: 5 · 1017 cpmÆmol)1) with 100 lL of cell suspension (5 · 106 cellsÆmL)1 final) in binding medium [modified Eagle’s medium with Earle’s salts (GIBCOInvitrogen-France), 0.2% BSA] in the presence of increasing concentrations of unlabeled sdAb (100 . Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting. we isolated from an immunized llama several high-affinity sdAbs directed against human carcinoembryonic antigen (CEA), a heavily glycosylated tumor-associated