fxr agonist treatment alters bile acid metabolism but exacerbates liver damage in a piglet model of short bowel syndrome

Accepted Manuscript FXR agonist treatment alters bile acid metabolism but exacerbates liver damage in a piglet model of short bowel syndrome Prue M Pereira-Fantini, Susan Lapthorne, Cormac G.M Gahan, Susan A Joyce, Jenny Charles, Peter J Fuller, Julie E Bines PII: DOI: Reference: S2352-345X(17)30041-3 10.1016/j.jcmgh.2017.02.008 JCMGH 217 To appear in: Cellular and Molecular Gastroenterology and Hepatology Accepted Date: 21 February 2017 Please cite this article as: Pereira-Fantini PM, Lapthorne S, Gahan CGM, Joyce SA, Charles J, Fuller PJ, Bines JE, FXR agonist treatment alters bile acid metabolism but exacerbates liver damage in a piglet model of short bowel syndrome, Cellular and Molecular Gastroenterology and Hepatology (2017), doi: 10.1016/j.jcmgh.2017.02.008 This is a PDF file of an unedited manuscript that has been accepted for publication As a service to our customers we are providing this early version of the manuscript The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain ACCEPTED MANUSCRIPT FXR agonist treatment alters bile acid metabolism but exacerbates liver damage in a piglet model of short bowel syndrome Short title: OCA treatment fails to prevent liver damage in SBS Prue M Pereira-Fantini1, Susan Lapthorne1, Cormac G.M Gahan 2,3,4 , Susan A Joyce2, 5, Jenny Charles6, Peter J Fuller7, Julie E Bines1, 8,9* RI PT Parkville, Victoria, Australia APC Microbiome Institute, University College Cork, Cork, Ireland 10 School of Microbiology, University College Cork, Cork, Ireland 11 School of Pharmacy, University College Cork, Cork, Ireland 12 School of Biochemistry, University College Cork, Cork, Ireland 13 14 15 Hudson Institute of Medical Research, Clayton, Victoria, Australia 16 Department of Gastroenterology and Clinical Nutrition, Royal Children’s Hospital, 17 Parkville, Victoria, Australia 18 SC M AN U EP TE D Department of Veterinary and Agricultural Sciences, University of Melbourne, Parkville, Australia Department of Paediatrics, University of Melbourne, Parkville, Australia AC C 19 Intestinal Failure and Clinical Nutrition Group, Murdoch Childrens Research Institute, 20 Grant support: This work was supported by the National Health and Medical Research 21 Council of Australia through a Senior Principal Research Fellowship to PF (#1002559) 22 MCRI and HMRI are supported by the Victorian Government’s Operational Infastructure 23 Program This publication has emanated from research supported in part by a research grant 24 from Science Foundation Ireland (SFI) under Grant Number SFI/12/RC/2273 ACCEPTED MANUSCRIPT Abbreviations: 27 SBS Short bowel syndrome 28 SBS-ALD Short bowel syndrome-associated liver disease 29 FXR Farnesoid X receptor 30 OCA Obeticholic acid 31 CA Cholic acid 32 CDCA Chenodeoxycholic acid 33 HCA Hyocholic aicd 34 LCA Lithocholic acid 35 DCA Deoxycholic acid 36 HDCA Hyodeoxycholic acid 37 UDCA Ursodeoxycholic acid M AN U TE D EP AC C 38 SC 26 RI PT 25 39 Correspondence: 40 Professor Julie E Bines (AGA member # 161139) 41 Department of Paediatrics, 42 The University of Melbourne, 43 Level 2, Royal Children’s Hospital, 45 50 Flemington Road, 46 Parkville, VIC 3052, Australia 47 Email: jebines@unimelb.edu.au 48 Phone: +61 9345 4137 49 Fax: +613 9345 6667 SC 44 RI PT ACCEPTED MANUSCRIPT M AN U 50 51 52 Disclosure summary: The authors have nothing to disclose TE D 53 Author contributions: 55 PP-F: Study concept and design; acquisition of data; analysis and interpretation of data; 56 drafting of the manuscript; statistical analysis 57 SL: Acquisition of data; critical revision of the manuscript for important intellectual content 58 SAJ: Acquisition of data; critical revision of the manuscript for important intellectual content 59 JC: Analysis and interpretation of the data; critical revision of the manuscript for important 60 intellectual content 61 PJF: Analysis and interpretation of the data; critical revision of the manuscript for important 62 intellectual content; administrative, technical or material support AC C EP 54 ACCEPTED MANUSCRIPT 63 JEB: Critical revision of the manuscript for important intellectual content; obtained funding; 64 study supervision 65 Word count: 3396 AC C EP TE D M AN U SC RI PT 66 ACCEPTED MANUSCRIPT SYNOPSIS 68 The FXR agonist obeticholic acid (OCA), has been shown to ameliorate cholestasis in liver 69 disorders However, in the context of liver disease secondary to bowel loss, OCA 70 administration exacerbated liver injury and repressed the expression of intestinal FXR target 71 genes RI PT 67 72 AC C EP TE D M AN U SC 73 ACCEPTED MANUSCRIPT ABSTRACT 75 Background and aims: Options for the prevention of short bowel syndrome-associated liver 76 disease (SBS-ALD) are limited and often ineffective The farnesoid X receptor (FXR) is a 77 newly emerging pharmaceutical target and FXR agonists have been shown to ameliorate 78 cholestasis and metabolic disorders The aim of the study was to assess the efficacy of OCA 79 treatment in preventing SBS-ALD 80 Methods: Piglets underwent 75% small bowel resection (SBS) or sham operation (sham) and 81 were assigned to either a daily dose of OCA (2.4mg/kg/day) or were untreated Clinical 82 measures included weight gain and stool studies 83 UPLC-MS was used to determine BA composition in end-point bile and portal serum 84 samples Gene expression of key FXR targets was assessed in intestinal and hepatic tissues 85 via qPCR 86 Results: OCA-treated SBS piglets exhibited decreased stool fat and altered liver histology 87 when compared with non-treated SBS piglets 88 depletion, however further analysis of bile and portal serum samples indicated OCA did not 89 prevent SBS-associated alterations in BA composition Expression of FXR target genes 90 involved in bile acid transport and synthesis increased within the liver of SBS piglets 91 following OCA administration whereas paradoxically, intestinal expression of FXR target 92 genes were decreased by OCA administration 93 Conclusions: Administration of OCA in SBS reduced fat malabsorption and altered bile acid 94 composition, but did not prevent the development of SBS-ALD We postulate that extensive 95 small resection impacts on the ability of the remnant intestine to respond to FXR activation SC RI PT 74 OCA prevented SBS-associated taurine AC C EP TE D M AN U Histological features were assessed 96 ACCEPTED MANUSCRIPT 97 Keywords: Short bowel syndrome; liver disease; intestinal failure-associated liver disease; 98 obeticholic acid; bile acids; Farnesoid X Receptor 99 RI PT 100 AC C EP TE D M AN U SC 101 ACCEPTED MANUSCRIPT INTRODUCTION 103 Short bowel syndrome (SBS) describes a condition of malabsorption and malnutrition 104 resulting from the loss of absorptive surface area after small bowel resection The 105 prevention of severe liver disease in patients with SBS is one of the major challenges in the 106 clinical management of these complex patients Short bowel syndrome associated-liver 107 disease (SBS-ALD) occurs in ~65% of infants following small bowel resection 108 cause of death in 3-19% of SBS infants Despite the high mortality associated with SBS- 109 ALD, the cause is not well understood and treatment options are limited RI PT 102 and is the SC M AN U 110 Using a preclinical, piglet model of SBS we have focused our work on uncovering the 112 molecular, metabolic and microbial alterations underpinning the development of SBS-ALD 113 Recently we have described SBS-ALD associated alterations in bile acid composition 114 associated with disrupted farnesoid X receptor (FXR) signaling mechanisms FXR is a 115 member of the nuclear hormone receptor family of transcription factors FXR is highly 116 expressed in the intestine and liver where it regulates the expression of genes involved in bile 117 acid synthesis, absorption and transport, thereby facilitating the emulsification and absorption 118 of both dietary fats and fat-soluble vitamins, whilst preventing the toxic accumulation of bile 119 acids within the liver Hence, there is increasing interest in the application of FXR agonists in 120 the treatment of gastrointestinal disease The most commonly studied FXR agonist is 121 obeticholic acid (OCA, INT-747), a potent, semi-synthetic analogue of the primary bile acid 122 chenodeoxycholic acid, which selectively activates FXR 123 hepatoprotective effects in patients with primary biliary cirrhosis 8, diabetes associated-non- 124 alcoholic fatty liver disease 125 suggested efficacy in patients with primary bile acid diarrhea 10 AC C EP TE D 111 6, OCA has demonstrated and non-alcoholic steaohepatitis A recent report also ACCEPTED MANUSCRIPT 126 Given the success of OCA administration in the prevention of liver disease in both mouse 128 models and human disease, we postulated that administration of OCA, to SBS piglets would 129 prevent the development of SBS-ALD via preservation of bile acid composition and FXR 130 signaling pathways within the liver and intestine 131 demonstrated in a variety of gastrointestinal settings, this is the first investigation of OCA 132 efficacy performed in the context of reduced bowel length and associated liver disease RI PT 127 SC Whilst OCA efficacy has been AC C EP TE D M AN U 133 ACCEPTED MANUSCRIPT activation models suggest that it is intestinal FXR activation that protects the liver from bile 346 acid associated damage These studies have shown that intestinal FXR activation confers 347 protection against hepatocarcinogenesis 24 and intrahepatic and extrahepatic cholestasis 25 via 348 restoration of the Fgf15/FGRF4 enteroheptic signaling axis and consequent upregulation of 349 bile acid detoxification and efflux pathways Conversely Modica et al., have suggested that 350 activation of the canalicular bile acid transport systems by hepatic FXR alone is unlikely to 351 provide hepatoprotection 352 targets were activated in SBS piglets treated with OCA, but failed to prevent liver disease In 353 the setting of SBS, intestinal FXR activation would be further hampered by removal of a 354 large portion of FXR containing cells in the resected intestine Hence, we postulate that 355 following extensive small bowel resection OCA is unable to generate sufficient FXR/FGF19 356 signaling to prevent SBS-ALD This is consistent with the current study where hepatic FXR TE D 357 M AN U SC 25 RI PT 345 358 FXR activation is also influenced by the composition of the bile acid pool 26 In this study we 359 observed significant disturbance of bile acid composition in SBS piglets 360 characterized by an increase in the primary bile acid HCA within the gallbladder and is 361 consistent with previous findings from our group27 HCA is a hydrophilic bile acid derived 362 from CDCA in the liver as a means of bile acid detoxification28 and the increase in HCA 363 observed in our study may reflect an adaptive response to bile acid dysmetabolism associated 364 with SBS However, OCA treatment failed to normalize HCA levels in our model and levels 365 of this bile acid remained significantly higher than sham controls despite OCA 366 administration We also observed decreases in the secondary/tertiary bile acids LCA, DCA, 367 HDCA and UDCA associated with SBS The conversion of primary to secondary/tertiary bile 368 acids is performed by the colonic microbiota therefore these changes likely reflect SBS- 369 associated microbial dysbiosis, as has been previously reported in this model29 Shifts in the AC C EP This was 20 ACCEPTED MANUSCRIPT secondary bile acid pool may be physiologically relevant as these bile acids are significant 371 agonists (DCA and LCA) or antagonists (UDCA) of FXR and also influence other host bile 372 acid receptors30 Following OCA treatment of SBS piglets, significant improvements in 373 HDCA and LCA levels were observed in systemic bile acid profiles (both gallbladder and 374 portal serum) despite a reduction in the expression of intestinal bile acid transport systems It 375 is plausible that OCA treatment impacts the intestinal microbiota and subsequently the 376 secondary bile acid pool This hypothesis is supported by findings from a murine model of 377 high-fat diet-induced nonalcoholic fatty liver disease, where antibiotic treatment altered bile 378 acid composition and inhibited FXR signaling in the ileum, but not in the liver31 Similarly 379 altering microbial composition via probiotic administration32 or administration of a high-fat 380 diet33, 34 is associated with reduced activity of the FXR/FGF15 signaling axis Further studies 381 are required to confirm if the disturbed intestinal FXR response observed in SBS piglets in 382 response to OCA is due to microbial dysbiosis and consequent bile acid dysmetabolism or 383 due to alternative activation of CYP3A4 that may impact on bile acid metabolism SC M AN U TE D 384 RI PT 370 In conclusion, this study is the first to assess the impact of treatment with OCA, an FXR 386 agonist on the development of SBS-ALD in a preclinical model of SBS Importantly, we have 387 shown that small bowel resection significantly hampers the intestinal response to OCA, but 388 not the hepatic response Our results suggest that there are fewer intestinal-based bile acid 389 targets and/or alterations in the resident microbiota4, 29 following extensive resection of the 390 small intestine and that this influences the ability of the intestine to respond to FXR 391 activation by OCA (Figure 5) 392 intestinal target genes studied, there was an upregulation of hepatic FXR target genes, 393 including those involved in limiting bile acid synthesis and facilitating bile acid transport but 394 this failed to prevent the development of SBS-ALD Although there may be clinical benefit AC C EP 385 Despite a lack of FXR activation by OCA amongst the 21 ACCEPTED MANUSCRIPT 395 of OCA on reducing fat malabsorption, it did not prevent the development of SBS-ALD 396 thereby limiting the potential therapeutic benefit of OCA in patients with SBS 397 RI PT 398 AC C EP TE D M AN U SC 399 22 ACCEPTED MANUSCRIPT ACKNOWLEDGEMENTS 401 The authors thank David Shapiro and Luciano Adorini (Intercept Pharmaceuticals) for their 402 kind provision of obeticholic acid MCRI is supporting by a Victorian Government 403 Infrastructure Grant RI PT 400 AC C EP TE D M AN U SC 404 23 ACCEPTED MANUSCRIPT 406 REFERENCES 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 10 11 12 13 14 15 16 17 18 19 20 RI PT SC M AN U TE D EP AC C Sukhotnik I, Siplovich L, Shiloni E, et al Intestinal adaptation in short-bowel syndrome in infants and children: a collective review Pediatric surgery international 2002;18:258-63 Bell RL, Ferry GD, Smith EO, et al Total parenteral nutrition-related cholestasis in infants JPEN J Parenter Enteral Nutr 1986;10:356-9 Bines JE, Pereira-Fantini P Cholestasis associated with Parenteral Nutrition Therapy Walker's Paediatric Gastrointestinal Disease: Pathophysiology, Diagnosis, Management 5th ed Hamilton, Canada: BC Decker Inc, 2007 Pereira-Fantini PM, Lapthorne S, Joyce SA, et al Altered FXR signalling is associated with bile acid dysmetabolism in short bowel syndrome-associated liver disease Journal of hepatology 2014;61:1115-25 Cheng Q, Inaba Y, Lu P, et al Chronic activation of FXR in transgenic mice caused perinatal toxicity and sensitized mice to cholesterol toxicity Molecular endocrinology 2015;29:571-82 Mudaliar S, Henry RR, Sanyal AJ, et al Efficacy and safety of the farnesoid X receptor agonist obeticholic acid in patients with type diabetes and nonalcoholic fatty liver disease Gastroenterology 2013;145:574-82 e1 Pellicciari R, Fiorucci S, Camaioni E, et al 6alpha-ethyl-chenodeoxycholic acid (6-ECDCA), a potent and selective FXR agonist endowed with anticholestatic activity Journal of medicinal chemistry 2002;45:3569-72 Hirschfield GM, Mason A, Luketic V, et al Efficacy of obeticholic acid in patients with primary biliary cirrhosis and inadequate response to ursodeoxycholic acid Gastroenterology 2015;148:751-61 e8 Neuschwander-Tetri BA, Loomba R, Sanyal AJ, et al Farnesoid X nuclear receptor ligand obeticholic acid for non-cirrhotic, non-alcoholic steatohepatitis (FLINT): a multicentre, randomised, placebo-controlled trial Lancet 2015;385:956-65 Walters JR, Johnston IM, Nolan JD, et al The response of patients with bile acid diarrhoea to the farnesoid X receptor agonist obeticholic acid Alimentary pharmacology & therapeutics 2015;41:54-64 Vignozzi L, Morelli A, Filippi S, et al Farnesoid X receptor activation improves erectile function in animal models of metabolic syndrome and diabetes Journal of Sexual Medicine 2011;8:57-77 Junqueira LC, Bignolas G, Brentani RR Picrosirius staining plus polarization microscopy, a specific method for collagen detection in tissue sections Histochem J 1979;11:447-55 Ruifrok AC, Johnston DA Quantification of histochemical staining by color deconvolution Anal Quant Cytol Histol 2001;23:291-9 RD L, LL A Supersaturated solutions of fat stains in dilute isopropanol for demonstration of acute fatty degeneration not shown by Herxheimer’s technique Archs.Path 1943;36:432 Rasband WS Image J U S National Institutes of Health, Bethesda, Maryland, USA, 19972012 Swann JR, Want EJ, Geier FM, et al Systemic gut microbial modulation of bile acid metabolism in host tissue compartments Proc Natl Acad Sci U S A 2011;108 Suppl 1:452330 Livak KJ, Schmittgen TD Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method Methods 2001;25:402-408 Lindor KD Farnesoid X receptor agonists for primary biliary cirrhosis Current opinion in gastroenterology 2011;27:285-8 Walters JR, Johnston IM, Nolan JD, et al The response of patients with bile acid diarrhoea to the farnesoid X receptor agonist obeticholic acid Aliment Pharmacol Ther 2015;41:54-64 Brown EM, Wlodarska M, Willing BP, et al Diet and specific microbial exposure trigger features of environmental enteropathy in a novel murine model Nat Commun 2015;6:7806 25 ACCEPTED MANUSCRIPT 493 26 27 28 29 30 31 32 33 34 RI PT 25 SC 24 M AN U 23 TE D 22 Verbeke L, Farre R, Verbinnen B, et al The FXR agonist obeticholic acid prevents gut barrier dysfunction and bacterial translocation in cholestatic rats The American journal of pathology 2015;185:409-19 Kunne C, Acco A, Duijst S, et al FXR-dependent reduction of hepatic steatosis in a bile salt deficient mouse model Biochimica et biophysica acta 2014;1842:739-46 Mookerjee RP, Mehta G, Balasubramaniyan V, et al Hepatic dimethylargininedimethylaminohydrolase1 is reduced in cirrhosis and is a target for therapy in portal hypertension Journal of hepatology 2015;62:325-31 Degirolamo C, Modica S, Vacca M, et al Prevention of spontaneous hepatocarcinogenesis in farnesoid X receptor-null mice by intestinal-specific farnesoid X receptor reactivation Hepatology 2015;61:161-70 Modica S, Petruzzelli M, Bellafante E, et al Selective activation of nuclear bile acid receptor FXR in the intestine protects mice against cholestasis Gastroenterology 2012;142:355-65 e14 Vaquero J, Monte MJ, Dominguez M, et al Differential activation of the human farnesoid X receptor depends on the pattern of expressed isoforms and the bile acid pool composition Biochemical pharmacology 2013;86:926-39 Pereira-Fantini PM, Lapthorne S, Joyce SA, et al Altered FXR signalling is associated with bile acid dysmetabolism in short bowel syndrome-associated liver disease J Hepatol 2014;61:1115-25 Gnerre C, Blattler S, Kaufmann MR, et al Regulation of CYP3A4 by the bile acid receptor FXR: evidence for functional binding sites in the CYP3A4 gene Pharmacogenetics 2004;14:635-45 Lapthorne S, Pereira-Fantini PM, Fouhy F, et al Gut microbial diversity is reduced and is associated with colonic inflammation in a piglet model of short bowel syndrome Gut Microbes 2013;4:212-21 Li T, Chiang JY Bile acid signaling in metabolic disease and drug therapy Pharmacol Rev 2014;66:948-83 Jiang C, Xie C, Li F, et al Intestinal farnesoid X receptor signaling promotes nonalcoholic fatty liver disease The Journal of clinical investigation 2015;125:386-402 Degirolamo C, Rainaldi S, Bovenga F, et al Microbiota modification with probiotics induces hepatic bile acid synthesis via downregulation of the Fxr-Fgf15 axis in mice Cell Rep 2014;7:12-8 Flynn CR, Albaugh VL, Cai S, et al Bile diversion to the distal small intestine has comparable metabolic benefits to bariatric surgery Nat Commun 2015;6:7715 Kim H, Kim DH, Seo KH, et al Modulation of the intestinal microbiota is associated with lower plasma cholesterol and weight gain in hamsters fed chardonnay grape seed flour J Agric Food Chem 2015;63:1460-7 EP 21 AC C 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 26 ACCEPTED MANUSCRIPT FIGURES 495 Figure 1: Clinical characteristics of untreated and OCA-treated sham and SBS piglets 496 (A) Portal OCA levels as measured by UPLC-MS, (B) weight gain, (C) stool consistency and 497 (D) stool fat score in untreated and OCA-treated sham and SBS piglets Mean ± SEM, **P < 498 0.01, ***P < 0.001 N=5-6/group 499 Figure 2: OCA treatment exacerbated SBS-associated liver injury Histological evidence 500 of fat droplet accumulation was observed in H&E stained liver sections of SBS piglets with 501 granulated hepatocytes apparent in OCA-treated SBS piglets (block arrow; Ai-iii) 502 droplet accumulation in SBS piglets was further confirmed by Oil red O staining (Bi and ii) 503 OCA-treated SBS piglets were also observed to exhibit evidence of lymphedema including 504 swelling of the capsule, the development of capsule tags, loose connective tissue around 505 portal structures and swollen fibroblasts (indicated by arrows; C) Mean ± SEM, *P < 0.05, 506 **P < 0.01, ***P < 0.001 N=5-6/group 507 Figure 3: SBS-associated alterations in bile acid composition were not prevented by 508 OCA treatment Concentration of taurine, unconjugated bile acid species and conjugated 509 bile acid species with bile (A) and portal (B) samples Mean ± SEM, *P < 0.05, **P < 0.01, 510 ***P < 0.001 N=5-6/group 511 Figure 4: OCA-treatment resulted in increased gene expression of FXR targets within 512 the liver, but paradoxically a decrease in FXR target gene expression in the intestine of 513 SBS piglets The relative gene expression of FXR gene targets within the liver (A) and 514 intestine (B) from untreated and OCA-treated sham and SBS piglets and portal FGF19 515 concentration (C) Mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001 N=5-6/group 516 Figure 5: Schematic depicting the potential influence of SBS-associated microbial 517 dysbiosis on OCA efficacy within the intestine Fat AC C EP TE D M AN U SC RI PT 494 27 ACCEPTED MANUSCRIPT 518 TABLES 519 520 Table 1: List of primer sequences and Universal ProbeLibrary probe combinations used in this study 521 AC C EP TE D M AN U SC RI PT 522 28 ACCEPTED Sequence 5’MANUSCRIPT to 3’ UPL probe agggtgacgccttgaattt CYP7A1 Reverse gggtctcaggacaagttgga SHP (NR0B2) Forward agtgctgcctggagtcctta SHP Reverse cctttcaggtaggcgtattcc MRP2 (ABCC2) Forward tcttggtgacacacagcattc MRP2 Reverse ttcccacaaccacaatctca #50 #60 aggtcagtttccaaccctgat OSTα (SLC51A) Forward cctgtttctcatccctgacg OSTα Reverse agcagcgctctcctcaga TE D BSEP Reverse caggagctgctggaagagat OSTβ Reverse gaccatgcttataatgaccacca EP OSTβ (SLC51B) Forward AC C SULT2A1 Forward #3 M AN U BSEP (ABCB11) Forward gcctgaccacgagcatct #46 RI PT CYP7A1 Forward SC Primer gcctcatcagttcccacct SULT2A1 Reverse gccttggacttgaagaaagc FGF19 Forward acaccatctgcccgtctct FGF19 Reverse cccctgcctttgtacagc IL-BP (FABP6) Forward gcaagaagttcaaggccact #3 #37 #60 #13 #77 ACCEPTED MANUSCRIPT IL-BP Reverse ggtggtagttggggctgtt HPRT1 Forward cagtcaacgggcgatataaaa HPRT1 Reverse caacaatcaagacattctttccag RPL32 Forward aactggccatcagggtcac RPL32 Reverse cacaactggaactcctgtctattc #22 AC C EP TE D M AN U SC RI PT #64 AC C EP TE D M AN U SC RI PT ACCEPTED MANUSCRIPT AC C EP TE D M AN U SC RI PT ACCEPTED MANUSCRIPT AC C EP TE D M AN U SC RI PT ACCEPTED MANUSCRIPT AC C EP TE D M AN U SC RI PT ACCEPTED MANUSCRIPT AC C EP TE D M AN U SC RI PT ACCEPTED MANUSCRIPT ...ACCEPTED MANUSCRIPT FXR agonist treatment alters bile acid metabolism but exacerbates liver damage in a piglet model of short bowel syndrome Short title: OCA treatment fails to prevent liver. .. cccctgcctttgtacagc IL-BP (FABP6) Forward gcaagaagttcaaggccact #3 #37 #60 #13 #77 ACCEPTED MANUSCRIPT IL-BP Reverse ggtggtagttggggctgtt HPRT1 Forward cagtcaacgggcgatataaaa HPRT1 Reverse caacaatcaagacattctttccag... 304 examined FXR agonist administration in a novel pathological setting- that of liver disease 305 associated with short bowel syndrome Administration of the FXR agonist OCA to SBS 306 piglets