Đang tải... (xem toàn văn)
110 Le Thi Phuong IDENTIFICATION OF THE FREQUENCY OF DRUG RESISTANCE MUTATIONS OF HELICOBACTER PYLORI IN GASTRIC PATIENTS IN HAI DUONG PROVINCIAL GENERAL HOSPITAL Le Thi Phuong Hai Duong Medical Techn[.]
110 Le Thi Phuong IDENTIFICATION OF THE FREQUENCY OF DRUG RESISTANCE MUTATIONS OF HELICOBACTER PYLORI IN GASTRIC PATIENTS IN HAI DUONG PROVINCIAL GENERAL HOSPITAL Le Thi Phuong Hai Duong Medical Technical University; phuongsinh@ymail.com Abstract - In this study, 131 gastric biopsies were taken from patients with gastritis who came to Hai Duong Provincial General Hospital for examination and treatment by request from January 2015 to July 2015 and they met the criteria: i) aged from 18-80; ii) infected with chronic gastritis, ulcer or gastric cancer; iii) not using antibiotic for a month before endoscopy These patients were taken for endoscopy to have endoscopic biopsy samples at the antrum, body and edge of the gastric ulcer, organizations suspected of contracting stomach cancer These DNA gastric biopsies were extracted and the 23S rRNA gene was amplified to detect Helicobacter pylori (H.pylori) The 23S rRNA gene in patients with H.pylori positive was sequenced to determine mutation related to anti-drug of H.pylori The results have shown that 58 of 131 (44.2%) gastric patients were infected with Helicobacter pylori and 15 of 58 (25.8%) patients with Helicobacter pylori infection were found to have mutations Key words - Mutation; Helicobacter pylori; Drug Resistance; Frequency; Gastric Ulcer Introduction Gastritis is a pathological condition that is relatively clear, causing mucosal irritation by exogenous or endogenous factors H pylori is known as a major cause or culprit of chronic gastritis, peptic ulceration and is the strongest known risk factor for gastric cancer, especially in developing countries [5, 7] Many studies have shown that H pylori is the leading cause of pre-gastric cancer and gastric cancer [8] People with H.pylori infection increase the risk of gastric cancer times higher than normal people In recent years, gastric diseases related to H pylori have been treated by using a regimen of anti- acid secretion and antibiotic in Vietnam as well as many countries in the world In fact, the appearance of drug - resistance of H.pylori strains has reduced the effect of drug eradication, so many patients were in the wrong treatment of H.pylori eradication or incomplete treatment Amoxicillin (Amox) and Clarithromycin (Cla) are frequently used in the treatment of H.pylori eradication (Dr Nguyen Van Thinh, 2010 - Hospital of Post and Telecoms), 23.7 % were found drug - resistant of H.pylori, much higher than other countries in Europe, America, West Asia, Hong Kong, Japan, and a little higher than Korea [4, 6] It is quite necessary to apply modern biomedicine techniques as PCR to determine the antibiotic resistance of H.pylori strains to have effective treatment Subjects and methods 2.1 Subjects 131 patients were examined by request from January 2015 to July 2015 in Hai Duong Provincial General Hospital and met the criteria: i) chronic gastritis, gastric ulcer or gastric cancer ii) not using antibiotic for one month before endoscopy 2.2 Methods: Cross - sectional study 2.2.1 Sampling process 131 patients were taken for endoscopy, then images of endoscopy were taken to determine the types of gastritis as: chronic gastritis, gastric ulcer, gastric cancer The endoscopic biopsy samples were taken at the antrum, body and edge of the gastric ulcer, organizations suspected of contracting stomach cancer The biopsy samples were stored in liquid nitrogen at 200 C or -700 C until research 2.2.2 DNA extraction DNA was extracted by improved conventional methods in accordance with our lab’s conditions The steps were performed as follows: the samples were crushed into flour, added 100 µl of LB (lysis buffer) to break up the cells, incubated at 370C for an hour; added 2.5 µl protease K (20mg/ml) and incubated at 560C overnight (8-16 hours); added a volume of 200 µl solution of CH3COONH4 7.5M, incubated at 40C for an hour; centrifuged 12,000 rpm, at 40C for 30 minutes; collecting the solution in the upper part (repeating this steps two times); added 500 µl of 96% ethanol (stored in cold), samples were stored at -200C for hours; centrifuged at 12,000 rpm, stored at 40C for 30 minutes; precipitated; added 500 µl of 70 % ethanol (to wash the collected precipitate), centrifuged at 12,000 rpm, at 40C for 20 minutes; precipitated; samples were dried at the temperature of the room The precipitate was dissolved in 30 µl of TE buffer and the samples were stored at -200C After DNA extraction, the agarose gel electrophoresis was used for DNA qualitative analysis 2.2.3 PCR amplification of 23S rRNA to identify the point mutations of H.pylori The 23S rRNA fragment gent was peculiarly amplified for two purposes: i) to determine H.pylori ii) to analyse and determine resistant mutations of H.pylori to Cla by DNA sequencing PCR was performed with 1- 10 mg of genomic DNA containing the specific primer pairs and components of reaction µl DNA (1-10 ng) was added into the 23-μl reaction mixture for H pylori-specific 23S rRNA gene amplification Forward: 5’-CCACAGCGATGTGGTCTCAG; Reverse: 5’- CTCCATAAGAGCCAAAGCCC (F: positions 1891-1911; R: positions2200–2220) ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO 6(103).2016 The thermal cycler used was set at 94 C for minutes in the first round; 35 cycles consist of: at 940 C, 45 sec at 560 C, at 720 C The last round was set for 10 minutes at 720C PCR products were analysed on Agarose gel 1.2%, 0.5 xTBE buffer 2.2.4 Analysis of point mutations in bioinformatics program Agarose gel electrophoresis 1.5% was used to check PCR products, 0.5xTAE buffer and cleaned with QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA) PCR sequencing was performed with Macrogen (Korea) 111 3.3 Amplification and sequencing the 23S rRNA for H.pylori infection identification Of 131 patients who were examined in Hai Duong Provincial Hospital, the results of PCR show 58 DNA samples with positive, 58/131 patients with H.pylori infection (H.pylori infection incidence was 44.2%) DNA fragments were amplified, directly sequenced and scanned by the BLAST program to determine if there was H.pylori origin For instance, PCR products of the patient ID 199 were 99% similar to the 23S rRNA gene sequences in 52 H.pylori strains Results 3.1 Total of DNA extraction Total of gastric biopsy specimens of patients with gastritis who were DNA extracted in Hai Duong Provincial General Hospital were checked on agarose gel 1.2% Figure shows the light trails on agarose gel 1.2% after electrophoresis as a result of being DNA extracted from specimens The bands in most lanes were bright and clear with molecular size of larger than 10 kb, which has shown high purity of being extracted DNA and less prone Figure The 23S rRNA fragment sequence Figure Agarose gel electrophoresis of total DNA products extracted from samples M: 1kb DNA ladder; 1→ 16: total DNA samples The results show that obtained products can be guaranteed for both quality and quantity in further studies 3.2 PCR reaction The 23S rRNA gene fragment which was amplified from DNA biopsy samples on agarose gel 1.2% was a band of about 400 bp in size; there might have bands in many cases (Figure 2) Because of the specific character of the 23S rRNA which carried a lot of repeated fragments, PCR products together formed different complexes M 10 11 12 13 14 15 Figure Checking PCR products of the 23S rRNA with agarose gel electrophoresis M: DNA standard ladder 100 base pairs; Positive samples: 3,4,5,6,7,8,12,13,15; Negative samples: 1,2,9,14 3.4 Searching for resistant mutations to Cla by using bioinformatics method Many studies have shown that there were points of resistant mutations at 2142 (A2142G and A2142C) and at 2143 (A2143G) in the peptidyl transferral of the 23S rRNA gene [2] We used the method of revealing point mutations in the 23S rRNA to identify Clarithromycin resistance However, we could not make antibiogramme due to severe infection among bacterium Bacterium did not continue to develop; they only existed in the coccoid form The resistant mutations to Cla at A2143G were present in 20.6% (12/58) and T2182C were present in 5.2% (3/58) (Figure 4) by using DNA test and bioinformatics Hence, the incidence of both mutations was 25.8% (15/58) These mutations decreased the association with drugs, the mutation at A2143G made resistant bacteria to Clarythromicin at a high level (4 µg/ml) Figure A2143G and T2182C in the 23S rRNA resistance to Cla were found in H.pylori strains isolated from patients There were not any resistance mutations to Cla in H.pylori, so they were sensitive to Clarithromycin (74.2%) Therefore, Cla is still used to eradicate H.pylori at present 112 Le Thi Phuong Figure shows the results of the 23S rRNA fragment gene sequence from antidrug patients with H.pylori infection Duc Toan (2012), the number of mutations at A2143G was 33.3%; there were not any mutations at A2142G [3] One of the most concerned issues is multi drug resistance (MRD) Currently, the prevalence of MRD tends to increase, a major cause of treatment failure However, our study in Hai Duong shows that there was only Cla resistance,not Amox resistance in patients Therefore, it is very important to design regimens for patients with H.pylori infection in Hai Duong 3.5 The results on the prevalence of H.pylori resistance to antibiotic Conclusion Of 131 gastric patients came to Hai Duong Provincial General Hospital for examination and treatment, 58 patients (44.2%) were found H.pylori infected The 23S rRNA gene fragment from patients with H.pylori infection was sequenced to detect Cla resistance mutations The frequency of A2143G mutation was found in 12 of 58 patients (20.6%) and T2182C in of 58 (5.2%) The number of patients with H.pylori infection did not carry Cla resistance mutations was 74.2% Hence, Cla is still used to eradicate H.pylori at present Table The prevalence of patients carried mutations in the 23S rRNA gene (resistance to Cla) REFERENCES A2143G mutation Figure The results of the 23S rRNA gene sequence from samples with positive mutations Results Patients carried mutations Rates % Non-mutations 43/58 74.2 Mutations 15/58 25.8 Total 58 100 Hence, the number of H.pylori resistance to Cla was 25.8% in Hai Duong The figure was higher than that of 5.5 % in the study by Nguyen Thuy Vinh et al (2004, Hanoi), but lower than that of 38.5% in the study by Le Dinh Minh Nhan et al (2006, Ho Chi Minh City) However, our study results were in accordance with studies in Asia The number of Cla resistance increased from 12.8% up to 23.8% (from 2000 to 2009 in China), from 7.00% up to 15.2% in Japan, from 7.6% up to 18.6% in Korea [1, 9] Hansomburana et al (Thailand, one of South Esat Asian countries) reported that the prevalence of mutations was the most common at A2142G (36.4%) and 18.2% of H.pylori strains simultaneously carried two mutations The study by Abadi A.T et al in Iran (2011) detected 93.7% mutation resistance to Cla at A2143G and 3.1% mutations at A2144G, but not any H.pylori strains simultaneously carried two mutations The studies in Viet Nam showed that mutations were primary at A2143G According to the study by Nguyen [1] Kim Jung Mogg1, Joo Sung Kim, Nayoung Kim, Yeoung Jeon Kim, In Young Kim, Young Joon Chee, Chul-Hoon Lee, and Hyun Chae Jung, 2008 Gene Mutations of 23S rRNA Associated with Clarithromycin Resistance in Helicobacter pylori Strains Isolated from Korean Patients J Microbiol Biotechnol 18(9), pp.1584-1589 [2] Mégraud Francis and Lehours Philippe, 2007 Helicobacter pylori Detection and Antimicrobial Susceptibility Testing Clin Microbiol Rev 2007 Apr; 20(2): 280-322 [3] Nguyen Duc Toan, Nguyen Van Thinh, Nguyen Thi Nguyet, Nguyen Thi Hong Hanh, Duong Thu Huong, Ta Long, Le Huu Song, 2012 The circumstances of antibiotic resistance of Helicobacter pylori in patients with gastritis and peptic ulcer Vietnamese Journal of Science and Digestion, 7(27), pp 1783-1788 [4] Nguyen Thi Hong Hanh, Nguyen Thi Nguyet, 2004 HP1125 variants Genetics and Applications, (3), pp -10 [5] Nguyen Thi Nguyet and Nguyen Thi Hong Hanh, 2004 The sequence of a domain in HP1125 gene coding for an outer membrane protein of Helicobacter pylori Genetics & Applications 2, pp.19-24 [6] Nguyen Van Thinh, Nguyen Thi Nguyet and Nguyen Thi Hong Hanh, 2007 “Summary of scientific reports and conferences” Basic research in the life sciences, pp.196-198 [7] Stephens J.C., Stewart J.A., Folwell A.M., Rathnone B.J., 1998 “Helicobacter pylori cagA status, vacA genotype and ulcer diseases” Eur J Gastroenterol Hepatol, pp 381-384 [8] Ta Long (2003), “Peptic disease and Helicobacter pylori bacteria” Hanoi Medical Publishing House [9] Wu W., Yang Y., Sun G., 2012 “Recent insights into antibiotic resistance in Helicobacter pylori eradication”, Gastroenterol Res Pract, pp 723- 783 (The Board of Editors received the paper on 18/01/2016, its review was completed on 01/04/2016) ... Macrogen (Korea) 11 1 3.3 Amplification and sequencing the 23S rRNA for H.pylori infection identification Of 13 1 patients who were examined in Hai Duong Provincial Hospital, the results of PCR show... sequence of a domain in HP 112 5 gene coding for an outer membrane protein of Helicobacter pylori Genetics & Applications 2, pp .19 -24 [6] Nguyen Van Thinh, Nguyen Thi Nguyet and Nguyen Thi Hong Hanh,... very important to design regimens for patients with H.pylori infection in Hai Duong 3.5 The results on the prevalence of H.pylori resistance to antibiotic Conclusion Of 13 1 gastric patients came