Identification Of The Pathogen Causing Root And Stem Rot Disease Asparagus (Asparagus Officinalis L.) Cultivated In Ninh Thuan Province

NGUYEN TAT THANH UNIVERSITY TRUE LEARNING - TRUE PRACTICE - TRUE SUCCESS - TRUE FUTURE NGUYEN TAT THANH FACULTY OF BIOTECHNOLOGY GRADUATION THESIS IDENTIFICATION OF THE PATHOGEN CAUSING ROOT AND STEM ROT DISEASE ASPARAGUS (Asparagus officinalis L.) CULTIVATED IN NINH THUAN PROVINCE Student’s name : Pham Thi Hong Gam Student ID :1711543905 Supervisor : MSc Nguyen Thi Nha Ho Chi Minh City, 2020 TABLE OF CONTENTS ACKNOWLEDGEMENTS i TABLE OF CONTENTS ii ABSTRACT V LIST OF FIGURES vi LIST OF TABLES vii LIST OF ACRONYMS viii INTRODUCTION ix CHAPTER LITERATURE REVIEW 1.1 An overview of asparagus plants 1.1.1 Classify 1.1.2 Morphological characteristics 1.1.3 Ecological characteristics 1.2 The nutritious and economic value of the asparagus plant 1.2.1 The nutritious and medicinal value of the asparagus plant 1.2.2 The economic value of asparagus .3 1.3 Production and consumption of asparagus in the World and Vietnam 1.3.1 Production and consumption of asparagus in the World 1.3.2 Production and consumption of asparagus in Vietnam 1.4 Diseases of asparagus 1.5 Identify the pathogen through morphological characteristics .8 1.6 Identify the pathogen through molecular characteristics 1.6.1 PCR reaction 1.6.2 ITS sequence region 1.6.3 Electrophoresis ii 1.7 Research situation in the world and Vietnam 1.7.1 Research situation in the world 1.7.2 Research situation in Vietnam 10 CHAPTER CONTENTS AND METHODS 12 2.1 Place of administration 12 2.2 Contents 12 2.3 Research materials 12 2.4 Methods 12 2.4.1 Sampling 12 2.4.2 Isolation and identification of the pathogenthrough morphological characteristics 12 2.4.2 Pathogenicity test 14 2.4.3 Determination of the pathogen by molecular identification 14 2.5 Inquiry into the temperature and pH effects of the growth and development of pathogens 19 2.5.1 Inquiry into the temperature effects of the growth and development of pathogens 19 2.5.2 Inquiry into the temperature effects of the growth and development of pathogens 19 The experiment to investigate the effect on the pH on the growth and development of the fungus were arranged including treatments, replicates/treatment, each treatment was one petri dish with a diameter of cm 19 CHAPTER RESULTS AND DISCUSSION 20 3.1 Morphological and cultured characteristics of asparagus root and stem rot pathogen in Ninh Thuan 20 3.1.1 Symptoms of disease 20 3.1.2 Isolation and purification of the pathogen 21 iii 3.1.3 Microscopic characteristics of the fungus that cause root and stem rot 22 3.2 Pathogenicity tests 23 3.3 Identify the pathogen through molecular characteristics 24 3.3.1 Results of electrophoresis of the PCR products in the ITS 18S rRNA sequence region 24 3.3.2 Sequencing PCR products 25 3.3.3 BLAST fungal strains isolated 26 3.3.4 Phylogenetic trees 27 3.4 Inquiry into the temperature and pH effects of the growth and development of fungi F equiseti and F proliferatum 29 3.4.1 Inquiry into the temperature effects of the growth and development of fungi F equiseti and F proliferatum 29 3.4.2 Inquiry into the pH effects of thegrowth and development of fungi F equiseti and F proliferatum 32 CONCLUSIONS AND RECOMMENDATIONS 37 REFERENCES 38 APPENDICES 41 IV ABSTRACT The study “Identification of the pathogen causing root and stem rot disease Asparagus (Asparagus Officinalis L.) cultivated in Ninh Thuan province” was carried out between April 2020 and September 2020 in Molecular Biology lab, Faculty of Biotechnology, Nguyen Tat Thanh University to identify the root and stem rot pathogens in Asparagus The contents of this study include: Identification of morphology and culture characteristics of root and stem rot disease among the Asparagus cultivated in Ninh Thuan; Identification of molecular pathogen; Pathogenicity test; Inquiry into the temperature and Hydrogen power (pH) effects of the growth and development of pathogens Results: Isolations of asparagus root and stem rot pathogen on PGA medium at room temperature for seven days, the mycelium is white, the filaments are spongy and pigmented on agar medium Fungal spores are crescent-shaped with the septum Genetic characteristics based on the 18S rRNA gene sequence revealed that fungal strains Fusarium sp in this study originated from the same species with the strains of Fusarium equiseti (isolated from many countries in the world such as Pakistan, China) and Fusarium proliferatum (isolated in the Netherlands with 100% similarity) The mycelium is mostly suitably grown and developed at 25 - 30 °C and becomes inhibited at 40 °C The pH effect also influences the growth and development of both fungi in this study The pH, which is acidic to neutral, is consistent with the growth and development of Fusarium equiseti and Fusarium proliferatum V LIST OF FIGURES Figure 1.1 Asparagus plant Figure 1.2 Common disease on asparagus Figure 1.3 ITS rRNA sequence region .9 Figure 3.1 Symptoms of root and stem rot disease in the field 20 Figure 3.2 Morphology of colonization on PGA medium 22 Figure 3.3 Fungal spores under a microscope 23 Figure 3.4 Results of pathogenicity test 24 Figure 3.5 Total DNA test 24 Figure 3.6 Results of the electrophoresis of PCR products 25 Figure 3.7 Results of reading the sequence file using BioEdit software 26 Figure 3.8 Results of BLAST strains isolated from group on the gene bank 26 Figure 3.9 Results of BLAST strains isolated from group on the gene bank 26 Figure 3.10 Phylogenetic tree isolated fungus 28 Figure 3.11 Effect of temperature on growth of F equiseti on petri dishes 30 Figure 3.12 Effect of temperature on growth of F proliferatum on petri dishes 31 Figure 3.13 Effect of pH on growth of F equiseti on petri dishes 33 Figure 3.14 Effect of pH on growth of F equiseti on petri dishes 35 vi LIST OF TABLES Table 2.1 Component content of PCR reaction 17 Table 2.2 PCR cycling conditions 17 Table 3.1 Reference strains 27 Table 3.2 Assessment of the effect of temperature on the growth of fungi F equiseti29 Table 3.3 Assessment of the effect of temperature on the growth of F proliferation 30 Table 3.4 Assessment of the effect of pH on the growth of F equiseti 33 Table 3.5 Assessment of the effect of pH on the growth of F proliferation 34 vii LIST OF ACRONYMS bp Base pair DNA Deoxyribonucleic Acid RNA Ribonucleic Acid rRNA ribosome Ribonucleic Acid BC Before Christ Hectare ITS Internal transcribed spacer NCBI National Center for Biotechnology Information BLAST Basic Local Alignment Search Tool WHO World Healthy Organization PGA Potato glucose agar WA Water agar rpm Round per PLS Plant lysis buffer PBB Plant binding buffer PWB Plant wash buffer EB Elution buffer TBE Tris - Borate - EDTA Rnase Ribonuclease PCR Polymerase Chain Reaction cv Coeff Var LSD Least significant difference Vlll INTRODUCTION Rationale for this thesis Asparagus (Asparagus officinalis L.), belongs to the genus Asparagus, Asparagaceae is a perennial vegetable native in the Middle East The product is a spear of the tree which is used as vegetables with high nutritious substances helping humans in health improvement Asparagus plants are more and more appreciated and expanded in several provinces such as Hai Phong, Binh Phuoc, Lam Dong, Tien Giang, Long An, Ho Chi Minh City, and Ninh Thuan In Binh Phuoc, Long An, Ninh Thuan provinces, and Ho Chi Minh City, the Asparagus has gradually replaced the low-value and lowyield vegetable crops to become the province's specific crops Asparagus is a light-demanding species and grows well in the tropics whose average annual temperature is always high Among the areas growing asparagus, Ninh Thuan province is the location with the most suitable conditions of soil and climate for planting and development on the large-scale Besides aloe vera, rice, apple, and grape, asparagus is identified as an agriculturally featured product of the province Asparagus, which is a high-class vegetable and a crop with high economic value, whose market is large both in domestic regions and foreign countries, therefore the acra growing asparagus has increased significantly in recent years However, the Asparagus is a long-day crop that is often affected by pests and diseases which are idiopathic in the farming process These idiopathic and common diseases including root and stem rot, Phytophthora rot, Phomopsis stem blight, rust, gray mold, purple spots, viral diseases, etc make the young shoots of the Asparagus grow poorly as well as affect the productivity and quality of asparagus in Ninh Thuan In particular, root and stem rot diseases are common with the red-brown pale and oval-shaped lesions on the roots, which gradually rot the tissue Rotten asparagus plants infect each other and the disease can spread exponentially and affect the quality and productivity of asparagus growing areas It is worth noting that until now, comprehensive studies have not yet been carried out to identify the root and stem rot pathogens in asparagus in our country With all above reasons, we implemented the thesis "Identification of the pathogen causing root and stem rot disease IX Asparagus (Asparagus officinalis L.) cultivated in Ninh Thuan province" to find the causation of the disease and take the most appropriate preventive measures Objectives - Identification of morphological characteristics of pathogens - Identification of molecular characteristics of the ITS rRNA sequence of pathogens - Determination of the effects of temperature, pH on the growth and development of pathogens on asparagus under in-vitro conditions X 32 Tamura K, Stecher G, Peterson D, Filipski A, Kumar s MEGA6: Molecular evolutionary genetics analysis version 6.0 Molecular biology and evolution 2013;30(12):2725-2729 33 Falloon p, Tate K Major diseases of Asparagus in New Zealand Paper presented at: Proceedings of the Agronomy Society of New Zealand 1986 34 Darmadi A, Suriani N, Sudirga s, Khalimi K First study on Fusarium equiseti: causes Fusarium wilt in tomato crop in Bali, Indonesia SABRAO Journal of Breeding and Genetics 2019;51(4):442-450 35 Leslie JF, Summerell BA The Fusarium laboratory manual John Wiley & Sons; 2006 36 Mohsen L, Al-Janabi JK, Jebor MA The effect of some environmental conditions on the growth and activity of the external enzymes for five sp of Fusarium Journal of University of Babylon 2016;24(3):630-646 40 APPENDICES Appendix Sequence of fungus isolated >SR1/NinhThuan/VietNam/2020 GAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT ATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGA CCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACT TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC CAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGG TGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTC CATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAAC CCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA TCAA >SR2 /NinhThuan/VietNam/2 020 GAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT ATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGA CCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACT TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC CAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGG TGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTC CATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAAC CCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA TCAA >SR3/NinhThuan/VietNam/2020 GAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT ATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGA CCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACT TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAG 41 TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC CAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGG TGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTC CATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAAC CCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA TCAA >SR4/NinhThuan/VietNam/2020 GAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT ATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGA CCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACT TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC CAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGG TGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTC CATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAAC CCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA TCAA >SR5/NinhThuan/VietNam/2020 GAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCA ATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGAC CCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTT TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGT AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC AGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTT GGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCT CGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCA AGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTG AACTTAAGCATATCAA 42 Appendix Anova statistic investigating the effect of temperature INQUIRY INTO THE TEMPERATURE EFFECTS ON F equiseti ON DAY The ANOVA Procedure Class Level Information Class Levels Values T NT1 NT2NT3NT4NT5 Number of Observations Read 15 Number of Observations Used 15 INQUIRY INTO THE TEMPERATURE EFFECTS ON F equiseti ON DAY The ANOVA Procedure Dependent Variable: N Sum of Source DF Squares Mean Square F Value Pr>F Model 10.15333333 2.53833333 Error 10 0.10000000 0.01000000 253.83 F T 10.15333333 2.53833333 253.83 F F T 80.00400000 20.00100000 1000.05 F Model 159.2866667 Error 10 0.0466667 Corrected Total 14 159.3333333 R-Square Coeff Var 0.999707 1.722177 DF Source T INQUIRY INTO 39.8216667 8533.21 F F Model 10.38266667 2.59566667 Error 10 0.17333333 0.01733333 Corrected Total 14 10.55600000 R-Square CoeffVar Root MSE 0.983580 13.71418 0.131656 DF Source T INQUIRY INTO Anova ss 149.75 F 149.75 F F 10.82566667 1476.23 F F T 103.2533333 25.8133333 717.04 F 0.0006 N Mean 3.340000 Mean Square F Value Pr > F 1.38266667 0.34566667 12.65 0.0006 THE EFFECT OF pH ON F equiseti ON DAY The ANOVA Procedure t Tests (LSD) for N NOTE: This test controls the Type I comparisonwise error rate, not the experimentwise error rate Alpha 0.01 Error Degrees of Freedom 10 Error Mean Square 0.027333 Critical Value of t 3.16927 Least Significant Difference 0.4278 INTO Means with the same letter are not significantly different t Grouping Mean N T A A B A B B B B c c c 3.8000 NT5 3.5000 NT4 3.3667 NT3 3.1000 NT2 2.9333 NT1 49 INQUIRY THE INTO OF EFFECT pH ON F equiseti ON DAY ON DAY The ANOVA Procedure Class Level Information Levels Class T Values NT1 NT2NT3NT4NT5 Number of Observations Read 15 Number of Observations Used 15 INQUIRY INTO THE EFFECT OF pH ON F equiseti ON DAY The ANOVA Procedure Dependent Variable: N Source DF Model Error 10 Sum of Squares Mean Square F Value Pr>F 1.48666667 0.37166667 557.50 F F F Value 7.646667 Mean Square F Value Pr > F 1.20766667 2.60 0.1005 OF pH ON F equiseti The ANOVA Procedure t Tests (LSD) for N NOTE: This test controls the Type I comparisonwise error rate, not the experimentwise error rate Alpha 0.05 Error Degrees of Freedom 10 Error Mean Square 0.464667 Critical Value of t 2.22814 Least Significant Difference 1.2401 Means with the same letter are not significantly different t Grouping Mean N T B B B B B B B A A A A A A A 8.4667 NT3 8.1000 NT4 7.4333 NT5 7.3667 NT2 6.8667 NT1 51 INQUIRY INTO INQUIRY The ANOVA Procedure Class Level Information Class Levels Values T NT1 NT2NT3NT4NT5 Number of Observations Read 15 Number of Observations Used 15 INTO THE EFFECT OF ON pH THE EFFECT OF pH F ON proliferatum ON DAY proliferatum ON DAY ON DAY The ANOVA Procedure Dependent Variable: N F Value Pr>F 1.68933333 0.42233333 158.37 F 1.68933333 0.42233333 158.37 F 0.32933333 0.08233333 41.17 F F T 10.80933333 2.70233333 675.58