Báo cáo khoa học: Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy pot

Light-induced reactions of Escherichia coli DNA photolyase monitored by Fourier transform infrared spectroscopy Erik Schleicher1,*, Benedikt Heßling2, Viktoria Illarionova1, Adelbert Bacher1, Stefan Weber3, Gerald Richter1,† and Klaus Gerwert2 Lehrstuhl fur Organische Chemie und Biochemie, Technische Universitat Munchen, Germany ă ¨ ¨ Lehrstuhl fur Biophysik, Ruhr-Universitat-Bochum, Germany ¨ ¨ Freie Universitat Berlin, Fachbereich Physik, Berlin, Germany ă Keywords DNA photolyase; DNA repair; FT-IR; pyrimidine dimer; stable-isotope labelling Correspondence G Richter, School of Biological and Chemical Sciences, University of Exeter, Stocker Rd, Exeter, EX4 4QD, UK Fax: +44 1392 26 3434 Tel: +44 1392 26 3494 E-mail: g.richter@exeter.ac.uk K Gerwert, Lehrstuhl fur Biophysik, ă Ruhr-Universitat-Bochum, Universitatsstr ă ă 150, 44780 Bochum, Germany Fax: +49 2343 21 4238 Tel: +49 2343 22 4461 E-mail: gerwert@bph.ruhr-uni-bochum *Present address Freie Universita Berlin, Fachbereich Physik, ăt Arnimallee 14, 14195 Berlin, Germany Cyclobutane-type pyrimidine dimers generated by ultraviolet irradiation of DNA can be cleaved by DNA photolyase The enzyme-catalysed reaction is believed to be initiated by the light-induced transfer of an electron from the anionic FADH) chromophore of the enzyme to the pyrimidine dimer In this contribution, first infrared experiments using a novel E109A mutant of Escherichia coli DNA photolyase, which is catalytically active but unable to bind the second cofactor methenyltetrahydrofolate, are described A stable blue-coloured form of the enzyme carrying a neutral FADH radical cofactor can be interpreted as an intermediate analogue of the light-driven DNA repair reaction and can be reduced to the enzymatically active FADH) form by red-light irradiation Difference Fourier transform infrared (FT-IR) spectroscopy was used to monitor vibronic bands of the blue radical form and of the fully reduced FADH) form of the enzyme Preliminary band assignments are based on experiments with 15N-labelled enzyme and on experiments with D2O as solvent Difference FT-IR measurements were also used to observe the formation of thymidine dimers by ultraviolet irradiation and their repair by light-driven photolyase catalysis This study provides the basis for future time-resolved FT-IR studies which are aimed at an elucidation of a detailed molecular picture of the lightdriven DNA repair process †Present address School of Biological and Chemical Sciences, University of Exeter, UK (Received December 2004, revised 10 February 2005, accepted 16 February 2005) doi:10.1111/j.1742-4658.2005.04617.x Cyclobutane pyrimidine dimers (Pyr< >Pyr) and pyrimidine–pyrimidone (6–4) photoproducts are the predominant structural modifications resulting from exposure of DNA to ultraviolet light [1,2] The structure of Pyr< >Pyr was elucidated by Blackburn and Davies already 40 years ago [3,4] Both photoproducts result from 2p+2p cyclo-additions The potentially mutagenic or lethal modifications [5] must be repaired in order to ensure cell survival and genetic stability This can be effected by excision-repair or by photoreactivation Abbreviations DTT, dithiothreitol; FT-IR, Fourier transform infrared; MTHF, 5,10-methenyltetrahydrofolylpolyglutamate; PyrPyr, cyclobutane pyrimidine dimmer FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS 1855 FT-IR on DNA photolyase mediated by DNA photolyases Specifically, photolyases catalyse the light-driven cleavage of the cyclobutane ring of tricyclic pyrimidine dimers, and (6–4) photolyases cleave the pyrimidine (6–4) pyrimidone photoproduct [6,7] Both enzymes have similar sequences [7,8] The protein family also includes the cryptochromes which participate in the regulation of circadian rhythms but appear to be devoid of DNA repair activity [9–11] The 3D structures of DNA photolyases (EC 4.1.99.3) from Escherichia coli [12], Anacystis nidulans [13] and Thermus thermophilus [14] have been determined by X-ray crystallography All enzymes use anionic reduced FADH) as redox-active cofactor [15–17] Both 5,10-methenyltetrahydrofolylpolyglutamate (MTHF) and 8-hydroxy-5-deazaflavin serve as light-harvesting cofactors in DNA photolyases [18–20] DNA photolyase of E coli is typically isolated as a blue-coloured protein carrying a neutral flavin radical, FADH•, as a chromophore This catalytically inactive form can be converted to the enzymatically active form by photoreduction Tryptophan 306 is believed to serve as the electron donor for this reaction on basis of site-specific mutagenesis studies [21], time-resolved electron paramagnetic resonance [22] and transient optical absorption experiments [23] Photolyase in the catalytically active FADH) form binds light-damaged DNA in a light-independent step with high affinity [24,25] Subsequent to photoexcitation of the FADH) cofactor by direct absorption of near-ultraviolet or visible light or by Forster-type ă energy transfer from the MTHF antenna chromophore [26], the excited-state FADH) chromophore is believed to donate an electron to the pyrimidine dimer in the DNA, thus generating a substrate radical anion and a E Schleicher et al neutral FADH• radical [17,22,27] The dimeric pyrimidine radical anion splits into pyrimidine monomers, and the excess electron is transferred back to the FADH• cofactor to regenerate the initial redox state of the flavin, FADH) (Fig 1) This paper describes the first examination of DNA photolyase by Fourier transform infrared (FT-IR) spectroscopy Specific infrared bands observed in difference FT-IR spectra are assigned to various photoprocesses in this experimental system Hence, this study provides the basis for future time-resolved FT-IR studies which are aimed at an elucidation of a detailed molecular picture of the light-driven DNA repair process Results Construction of a DNA photolyase E109A mutant MTHF, the second cofactor of E coli DNA photolyase, acts as a light-harvesting antenna However, the protein has a relatively low affinity for this cofactor which is therefore partially lost during purification [28] Thus, individual wild-type enzyme batches typically differ in their MTHF content Heterogeneity of the enzyme with respect to the chromophores, however, is a serious handicap for spectroscopic studies In order to obtain enzyme batches with reproducible absorption properties, we therefore decided to construct a mutant protein that does not bind MTHF but is nevertheless enzymatically active X-ray structure analysis has shown that the position-2 amino group and the position-3 imino group of the pteridine moiety of MTHF form hydrogen bonds Fig Putative repair reaction mechanism of DNA photolyase 1856 FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS E Schleicher et al with the c-carboxylic group of glutamate residue 109 [12] Therefore we replaced the glutamate codon by a codon specifying alanine using PCR-driven site-directed mutagenesis A recombinant Bacillus subtilis strain carrying the resulting plasmid p602E109A expressed DNA photolyase to a level of about 15% of total cell protein Purification by published procedures afforded the blue radical form of the mutant enzyme The yield of isolated protein was about twofold higher than that obtained with the recombinant E coli strain described earlier [29] The blue radical forms of wild-type photolyase and the E109A mutant protein show similar absorption spectra in the visible range above 450 nm (Fig 2A) At shorter wavelengths, however, the absorbance of the mutant protein is substantially lower than that of the wild-type enzyme The absorbance difference FT-IR on DNA photolyase between the wild-type and the mutant enzyme (Fig 2B) closely resembles the spectrum of enzymebound MTHF [30] Both the blue radical form of wild-type and mutant protein could be converted into the catalytically active form by photoreduction [15] The photobleached wildtype and mutant protein forms were both devoid of significant absorbance at wavelengths above 500 nm (Fig 2) In the short-wavelength range, the absorbance of the mutant protein was again substantially lower than that of the wild-type enzyme (Fig 2A), and the absorbance difference between the proteins under study was again similar to the spectrum of MTHF (Fig 2B) These data show that the mutant protein is devoid of MTHF, and its long-wavelength absorption is exclusively due to the flavin chromophore All subsequent experiments were performed with the catalytically active mutant protein [catalytic activity was measured by absorbance changes of UV-irradiated oligo-(dT)18 DNA at 260 nm (data not shown)] which appears as a valid model for the study of the DNA photorepair process Photoactivation of the catalytically blue radical form of DNA photolyase Overexpression strains of E coli can generate large amounts of recombinant DNA photolyase in the catalytically active dihydroflavin form, but the typical isolation procedures are conducive to the conversion of the enzyme into a catalytically inactive form characterized by strong optical absorption in the range 400– 650 nm That blue-coloured species contains the flavin chromophore in the neutral radical form as shown in some detail by EPR analyses [20,29,31] The catalytically active pale yellow dihydroflavin form can be easily regenerated by photoreduction of the radical form in the presence of an appropriate electron donor such as dithiothreitol (see Fig 3) With regard to its electronic state, the stable but catalytically inactive blue radical form of the enzyme appears as a valid model of the transient flavin radical species that is believed to be involved in the catalytic Fig UV ⁄ vis spectra of E coli DNA photolyase at different redox states (A) Dashed line, wild-type DNA photolyase in the blue radical form; dotted line, wild-type DNA photolyase in the reduced form; solid line, E109A DNA photolyase in the blue radical form; short dotted line, E109A DNA photolyase in the reduced form (B) Solid line, difference spectrum of wild-type and E109A DNA photolyase both in the radical form; dashed line, difference spectrum of wild type and E109A DNA photolyase both in the fully reduced form FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS Fig Schematic photoreduction of the flavin semiquinone radical 1857 FT-IR on DNA photolyase Fig FT-IR difference spectra of DNA photolyase (A, A¢) Photoreduction of DNA photolyase (two different batches of protein) (B) Photoreduction of [U-15N]-DNA photolyase (C) Photoreduction of DNA photolyase in D2O-containing buffer; double differences are shown in lanes D–F (D) Subtraction of A¢ from A (E) Subtraction of (B) from (A) (F) Subtraction of (C) from (A) (DA ¼ absorbance difference [absorbance units], DDA ¼ double absorbance difference [absorbance units]) DNA-repair cycle (Fig 1) Furthermore, a flavin radical is also involved in the light-driven photoreduction of the blue radical enzyme species We therefore decided to study this photoreduction of the stable blue radical form of the enzyme to the catalytically competent FADH) form by FT-IR spectroscopy Infrared spectra of 1.2-mm solutions of blue radical enzyme were measured at °C in the dark The enzyme samples were then irradiated for with red light (k > 530 nm) Infrared spectra were again obtained and were subtracted from the respective preirradiation spectra affording the difference spectrum shown in Fig 4A Positive as well as negative difference bands with relative intensities up to 0.1% were 1858 E Schleicher et al observed Positive signals represent vibrational transitions characteristic of the enzymatically active FADH) form, and negative bands indicate vibrational transitions of the blue radical form The reproducibility of the measurements was excellent As an example, the traces A and A¢ in Fig were obtained with independently prepared enzyme batches The close similarity between the infrared characteristics of the two samples is illustrated by subtraction of trace A¢ from trace A affording the double difference spectrum shown as trace D in Fig The most salient features in the difference spectra (Fig 4A) were bands at 1532 and 1396 cm)1, and changes in the amide-I (1600–1700 cm)1) region The frequencies of infrared bands can be modulated by isotope substitution Growth of the recombinant E coli strain used for production of photolyase on minimal medium supplemented with 15NH4Cl as the sole source of nitrogen afforded enzyme with 15N substitution of most amino acids (with the exception of tryptophan, lysine, threonine and methionine which were added to the culture medium in unlabelled form; whereas they may be partially 15N-labelled by reversible transamination, their 15N abundance has not been determined) Moreover, since the production strain is autotrophic with respect to riboflavin biosynthesis, the flavin chromophore of the biosynthetically labelled enzyme is also rendered universally 15N labelled Photoreduction of the 15N-labelled blue radical enzyme afforded difference infrared spectra with a significantly modified pattern of absorption bands attributed to the blue radical form (negative bands of trace B in Fig 4) and to the catalytically active FADH) form obtained after photoreduction (positive bands of trace B in Fig 4) The difference spectrum is qualitatively similar to trace A, but the intense negative band at 1532 cm)1 in trace A is shifted to 1524 cm)1 and the positive band at 1396 cm)1 in trace A has disappeared A more detailed assessment of the impact of 15N substitution is possible by inspection of the double difference in trace E which is obtained by subtraction of trace B from trace A in Fig In contrast to trace D in Fig 4, the difference bands not cancel out This indicates that numerous vibration bands have shifted as a consequence of the universal 15N labelling Major differences are especially observed in the region between 1500 and 1700 cm)1 Acidic protons in the protein can easily be exchanged by dialysis against D2O The photoreduction of such treated enzyme sample afforded difference infrared spectra indicating frequency modulation of a considerable number of vibration modes The photoFEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS E Schleicher et al reduction of the radical form in D2O buffer is shown in trace C in Fig 4, which is again qualitatively similar to trace A, but the negative band at 1532 cm)1 has shifted to 1530 cm)1, and the band at 1396 cm)1 in trace A appears with substantially reduced intensity The residual intensity at this frequency (trace C of Fig 4) can be attributed to incomplete H«D exchange Again, the impact of deuterium replacement of acidic protons is best observed after subtraction of trace C from trace A affording the double-difference spectrum shown as trace F in Fig As in the case with 15N substitution, the partial deuteration has affected the frequencies of numerous signals, notably in the range between 1500 and 1700 cm)1 Photodamaging of thymidine oligonucleotides Oligo-(dT)18 DNA was used to monitor the formation of thymidine dimers by difference FT-IR spectrometry An excimer laser with its emission at 308 nm was used to irradiate a 4-mm solution of oligothymidine placed inside the infrared spectrometer The subtraction of an infrared spectrum acquired prior to UV-irradiation from a spectrum obtained after irradiation afforded the difference spectrum shown as trace A in Fig The photoreaction results in positive difference bands at 1464, 1396 and 1302 cm)1 which belong to the photodamaged form of DNA Negative difference bands are observed at 1483, 1424 and 1289 cm)1 and Fig FT-IR difference spectra of DNA (A) Oligo-(dT)18 DNA photodamage with UV radiation in the absence of photolyase (B) Oligo-(deoxy-5-fluorouracil)12 DNA photodamage with UV radiation in the absence of photolyase (DA ¼ absorbance difference [absorbance units]) FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS FT-IR on DNA photolyase belong to undamaged DNA In summary, photodamage afforded highly characteristic and reproducible changes in the vibrational spectrum of DNA Photodamaging of 5-fluoro-uridine oligonucleotides Similar irradiation experiments were performed with dodecameric deoxyoligonucleotide where the methyl group is replaced by fluorine (deoxy-5-fluoro-uridine) The difference spectrum observed with this oligonucleotide (Fig 5B) is similar to that observed for the photodamage of oligo-deoxythymidine The spectrum of the irradiated deoxy-5-fluorouridine oligonucleotide shows major positive difference bands at 1741, 1460 and 1392 cm)1 and negative bands at 1715, 1410, 1364 and 1274 cm)1 DNA photorepair The subsequent experiments addressed the enzymemediated repair of UV-damaged DNA which had been prepared by broadband ultraviolet irradiation of the oligo-(dT) DNA substrate Permanganate titration of the irradiated DNA showed that about 50% of the bases had been converted to dimers (data not shown) Samples containing a mixture of photodamaged DNA and blue radical enzyme at an approximate fourfold excess of thymidine dimers with respect to enzyme molecules were irradiated in a two-step procedure Initially, the enzyme was photoreduced to the catalytically active form by irradiation with red light (> 530 nm) This reaction was followed by difference FT-IR spectrometry which afforded a difference spectrum closely similar to that shown as trace A in Fig (data not shown) and confirmed that photorepair of DNA had not occurred This is in agreement with published data indicating that photorepair requires irradiation in the wavelength range below 530 nm [32] The sample was then irradiated with white light for a period of During this irradiation period, infrared spectra were recorded at intervals Subtracting the spectrum obtained before the white-light irradiation from each of the subsequent spectra afforded a series of difference spectra shown in Fig 6A These difference spectra comprise numerous positive as well as negative bands A plot at various amplitudes vs time indicates that absorption differences at specific wavelengths progress with significantly different kinetics (Fig 6B) More specifically, a number of bands reach saturation levels within a period of about 10 (e.g bands at 1464, 1396, 1302 and 1244 cm)1, whereas other bands 1859 FT-IR on DNA photolyase E Schleicher et al Fig FT-IR difference spectra of DNA photolyase and DNA (A) Oligo-(dT)18 DNA photodamage with UV radiation in the absence of photolyase (B) Photoreactivation of DNA photolyase followed by DNA photorepair (after 20 white-light irradiation) Addition of spectra A and B is shown in lane C (DA ¼ absorbance difference [absorbance units]) Fig Repair FT-IR difference spectra measured at time intervals of (A) The relative change of selected bands with time (B) (DA ¼ absorbance difference [absorbance units]) required up to about twice as much time to reach saturation levels (e.g bands at 1540 and 1520 cm)1) For a preliminary interpretation of the infrared difference bands accompanying the light-driven enzymatic repair of photodamaged DNA, the traces in Fig 6A can be compared with the difference spectrum describing the UV-light driven formation of thymidine dimers (trace A in Fig 5) For ease of viewing, trace A of Fig is depicted again in Fig as trace A, and the time trace after 20 of white-light illumination in Fig 6A is depicted again in Fig as trace B It is obvious that a number of difference bands appear in these traces with opposite signs and essentially cancel out upon summation of traces A and B affording trace C Notably, the bands that cancel out in this way are essentially those that reach saturation at early times in the photorepair experiments shown in Fig 6B This suggests that these bands are characteristic of thymi1860 dine dimers which are either formed by UV radiation or consumed in the enzyme-mediated photorepair experiments Discussion The study of presteady-state kinetics has been predominantly the domain of absorption and fluorescence spectroscopy in the visible and ultraviolet ranges These methods combine high sensitivity and selectivity with excellent time resolution down to the level of femtoseconds However, many enzyme substrates and reaction intermediates are devoid of appropriate chromophoric groups Moreover, it is difficult to assign optical transients to specific intermediate structures due to the paucity of structural information in the visible and ultraviolet frequency ranges Infrared spectroscopy combines the advantages of sensitivity and high time resolution with a wealth of spectroscopic information on the reacting species and can be applied to virtually any reactant However, the interpretation is hampered by the fact that virtually all FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS E Schleicher et al FT-IR on DNA photolyase components of the reaction mixture contribute to the infrared absorption This lack of selectivity in the vibration frequency range can be addressed in different ways Notably, selective stable-isotope labelling can be used as a basis for band assignments Several aspects of DNA photolyase are favourable for an in depth presteady-state kinetic analysis (a) By ultra-short laser pulses the enzyme reaction can be triggered with a high quantum yield (b) The FAD cofactor and the DNA substrate can be observed in the visible and ⁄ or ultraviolet ranges as well as in the IR range (c) Selective stable-isotope labelling is feasible for the FAD chromophore, the apoenzyme and the DNA substrate This study was designed to explore the potential of infrared spectroscopy for this enzymatic system The data show that several chemical processes can be observed with high reproducibility in the infrared frequency range Most notably, we were able to monitor the enzymatic repair of DNA Moreover, it was shown that stable-isotope labelling can be used for the purpose of signal assignment to specific molecular vibrations Clearly, selective labelling of the flavin cofactor, the substrate and of specific amino acid types in the apoenzyme should be able to generate a wealth of information at a molecular level Although all molecular components present in the samples used in this work are expected to contribute to the infrared envelope, the photochemical processes studied influence predominantly the structures of the flavin chromophore and the pyrimidine moiety of DNA Changes in these structural motifs are therefore more likely to afford difference infrared bands of significant intensity as compared to the apoprotein With these assumptions, some tentative signal assignments can be made These are discussed below band was also observed in more recent resonance Raman experiments [34] Albeit located at 1529 cm)1, no significant shift was observed after D2O treatment Assuming that the slight offset between the Raman and infrared bands (1528 ⁄ 1529 cm)1 vs 1532 cm)1) is due to calibration uncertainties, we propose that this band can be attributed to the flavin chromophore in the blue radical form on the basis of the resonance Raman activity In photoreduction experiments with photolyase in buffer containing D2O (trace C in Fig 4), the absorption signal at 1396 cm)1 (attributed to the FADH) form) showed significantly reduced intensity; the residual intensity at 1396 cm)1 was attributed to incomplete H«D exchange This band can be tentatively assigned to H(5) in plain rocking mode of FADH) Deuterium substitution of the chromophore would be expected to shift this band to the frequency range around 900 cm)1; however, the detection of the hypothetical band was not possible due to the insufficient transparency of the sample in this frequency range A new difference band observed after H«D exchange at 1423 cm)1 is indicative of a coupled vibration mode at 1396 cm)1 Additional support for this assumption comes from uniform isotopic 15N labelling of DNA photolyase Photoreduction results in a splitting of the former absorbance at 1396 cm)1 into two new lines at 1382 and 1405 cm)1 indicating the contribution of at least two modes (Fig 4B) We find distinct absorbance changes in the range of amide-I vibrations (1675 ⁄ 1660 ⁄ 1644 ⁄ 1625 cm)1) showing some variation in their relative intensity As no absorbance change is observed above 1700 cm)1, the C¼O stretching range of protonated carbonyls, a protonation or environmental change of carbonyl groups during photoreduction is excluded Photoactivation of DNA photolyase Photodamage of DNA Red-light irradiation selectively induced the one-electron reduction of the blue radical enzyme and did not cause any changes in the DNA (neither photodamage nor photorepair) The accompanying 1532 cm)1 difference band was not affected by the presence of intact or photodamaged DNA (data not shown) Universal 15 N labelling or replacement of acidic protons by deuterium caused bathochromic shifts of this band of and cm)1, respectively (traces B and C in Fig 4) Previous resonance Raman experiments on E coli DNA photolyase [33] showed an intense band at 1528 cm)1 which experienced bathochromic shifts of or cm)1 in samples which were labelled with 15N or which have been treated with D2O, respectively This The ultraviolet irradiation of DNA afforded several positive as well as negative difference bands which can be attributed to the consumption (negative difference bands at 1425, 1326 and 1289 cm)1) and the formation (positive difference bands at 1464, 1396 and 1302 cm)1) of thymidine dimers, respectively An experiment with DNA carrying fluorouracil instead of thymidine afforded a qualitatively similar difference spectrum, but minor shifts in the bands appeared that are qualitatively reproduced by model calculations of the vibration modes of thymidine as compared to fluorouridine: Tavan and coworkers have recently calculated an approximate 20-cm)1 blue shift both of the C(2)¼O(2) and C(4)ẳO(4) carbonyl-stretch FEBS Journal 272 (2005) 18551866 ê 2005 FEBS 1861 FT-IR on DNA photolyase vibrations due to replacement of fluorouracil with thymidine [35] Hence, this shift is required to disentangle the carbonyl stretch vibrations of the thymidine dimer from those of carbonyl vibrations from the protein and dominant water vibrations By exploiting this frequency shift, the strong vibration band at 1741 cm)1 is assigned to the C(4)¼O(4) carbonyl-stretch vibration of the fluorouracil dimer and the strong vibration band at 1715 cm)1 to the C(4)¼O(4) carbonyl-stretch vibration of fluorouracil monomer The examination of fluorouracil-containing substrate therefore provides an important tool for the investigation of carbonyl vibrations involved in the DNA-repair process Enzyme-catalysed photorepair of photodamaged DNA For a preliminary interpretation of the infrared difference bands accompanying the light-driven enzymatic repair of photodamaged DNA, the traces in Fig 6A can be compared with the difference spectrum describing the UV-light driven formation of thymidine dimers (trace A in Figs and 7) The major difference bands between 1270 cm)1 and 1470 cm)1 (Figs 6A and 7B) can be associated with thymidine-dimer repair under quasi-steadystate conditions Although experimental conditions vary between data reported by Jorns and coworkers, the overall rate for thymidine repair is in the same range [36] and clearly shows the potential of FT-IR spectroscopy for direct measuring of kinetic rate constants However, the photorepair is also accompanied by certain additional difference bands in the spectral range of 1520–1540 cm)1 A preliminary kinetic analysis shows that these bands appeared at a slower rate as compared to those which can be clearly associated with DNA repair Hence, the bands in this range represent a slower secondary process which cannot yet be assigned to a specific molecular process on the basis of the available data The antisymmetric PO2– stretching vibration is a characteristic marker for nucleic-acid backbone conformation and is located between 1220 and 1240 cm)1, depending on the helical conformation [37] When irradiating oligo-(dT)18 DNA, the conformation of the backbone of a single-strand DNA is not expected to change dramatically It is well known from footprinting, crystallographic and NMR studies that the backbone conformation is substantially distorted in double-stranded DNA containing a single Pyr< >Pyr [38–40] However, this should be different in singlestranded DNA, which is known to be much more flexible in solution Therefore, no major difference band is expected in this frequency region (trace A in Fig 5) If 1862 E Schleicher et al thymidine dimer repair occurs, the conformation of the backbone should, on the other hand, change while the enzyme–product complex decays (or the enzyme– substrate complex is formed), because the chemical environment of the backbone phosphate is altered: In an enzyme–DNA complex, electrostatic interaction of backbone phosphate and basic residues of the DNA photolyase significantly contribute to the DNA binding of the enzyme [41–44] Therefore, an additional difference band at 1244 ⁄ 1224 cm)1 can be detected in Fig 7B Interestingly, the kinetics of the formation of the positive band at 1224 cm)1, which can be assigned to the formation of enzyme-unbound oligo-(dT)18 DNA, are different to that of the bands assigned to thymidine dimer repair (Fig 6B) Time constants under quasi-steady-state conditions for photolyase binding to UV-damaged DNA in the millisecond range have been reported by direct methods using stopped-flow experiments [34] They represent the rate determining steps of substrate-to-enzyme binding, which is expected to vary depending on the experimental conditions used Given the highly viscous buffer solution [50% (v ⁄ v) glycerol], the low temperature (4 °C) at which our FT-IR experiments were carried out, and the higher relative substrate concentration, it is not surprising that significantly longer time constants (approximate 350 s) are observed in our studies (Fig 6B) In summary, characteristic infrared bands assigned to the enzyme as well as the DNA substrate can be associated with DNA photorepair These observations can form the basis for time-resolved single turnover experiments, which require time-resolved FT-IR experiments on a picosecond timescale Experimental procedures Materials Restriction enzymes and DNA ligase were from New England BioLabs (Frankfurt am Main, Germany) and from Roche Diagnostics (Mannheim, Germany) Taq DNA polymerase was from Eurogentec (Seraing, Belgium) Dithiothreitol was from Sigma Oligonucleotides were customsynthesized by MWG Biotech (Ebersberg, Germany) 15 NH4Cl was from Cambridge Isotope Laboratories (Andover, MA, USA) Microorganisms and plasmids are summarized in Table Site directed mutagenesis A procedure modified after Marini et al [45] was used for site-directed mutagenesis Plasmid pEPHR [29] was used as template All primers used are shown in Table FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS E Schleicher et al FT-IR on DNA photolyase plated on LB agar containing 15 mgỈL)1 kanamycin and 10 mg L)1 erythromycin Table Bacterial strains, plasmids and primers Strain or plasmid E coli M15[pREP4] M15[pGB3] XL1-Blue B subtilis BR151[pBL1] Plasmids pNCO113 pEPHR pE109A p602-CAT p602E109A Genotype or relevant characteristic Reference Cultivation of bacterial cells + + lac,ara,gal,mtl,recIA , uvr [pREP4,lacI, kanr] lac,ara,gal,mtl,recIA+, uvr+ [pGB3,lacI, blar] recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac[F¢, proAB, lacIqZ?M15, Tn10 (tetr)] [49] [50] [51] trpC2,lys-3,metB10 [pBL1,lacI,eryr] [46] expression vector for E coli pNCO113 with the phr gene of E coli pNCO113 with the phr gene of E coli with mutation Glu109Ala expression vector for B subtilis p602-CAT with the phr gene of E coli with mutation Glu109Ala [50,52] [29] This study [53] This study Primers (5¢-3¢) M1 (forward) GAGCGGATAACAATTTCACACAG Rct (reverse) ACAGGAGTCCAAGCTCAGCTAATT Ply5 (mismatch) CCCGGGCCCGCGCATTCACTTCATACTG The general scheme of mutagenic PCR involved two rounds of amplification cycles using one mismatch and two flanking primers (primers M1, Rct and Ply5, Table 1) During the first round, five amplification cycles were carried out with the respective mismatch primer and with one of the flanking primers The second flanking primer was then added and the reaction was continued for 10 additional cycles The PCR fragment was cleaved with the restriction endonucleases EcoRI and BamHI and was then ligated into the expression vector pNCO113 yielding the plasmid pE109A For methylation of DNA, this construct was electroporated into the E coli strain XL1-Blue and plated on Luria–Bertani (LB) agar containing 150 mgỈL)1 ampicillin The plasmid was reisolated and electroporated into the expression strain M15[pREP4], which was then plated on LB agar containing 150 mgỈL)1 ampicillin and 15 mgỈL)1 kanamycin Transformants were monitored for expression of DNA photolyase Construction of an expression plasmid Plasmid pE109A was digested with restriction endonucleases EcoRI and BamHI The resulting 1416-bp fragment was isolated and was ligated into the vector p602-CAT The resulting plasmid p602E109A was electrotransformed into E coli M15[pGB3] cells, which were plated on LB agar containing 150 mgỈL)1 ampicillin and 15 mgỈL)1 kanamycin The plasmid p602E109A was reisolated and electrotransformed into B subtilis BR151 cells [46] which were FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS The recombinant B subtilis strain harbouring plasmids p602E109A and pBL1 was cultured in baffled 2-L Erlenmeyer flasks containing 700 mL LB medium supplemented with 15 mg L)1 kanamycin and 10 mg L)1 erythromycin The cultures were incubated at 32 °C with shaking At an optical density of 0.7 (600 nm), isopropylthio-b-dgalactopyranoside was added to a final concentration of mm, and incubation was continued overnight The cells were harvested by centrifugation and stored at )20 °C Preparation of 15 N-labelled DNA photolyase The recombinant B subtilis strain harbouring the plasmids p602E109A and pBL1 was cultured in baffled 2-L Erlenmeyer flasks with 700 mL mineral medium containing (L)1), g Tris, 0.35 g K2HPO4, g glucose, 0.138 g MgSO4, g 15NH4Cl, 5.55 mg CaCl2, mL vitamin concentrate, mL trace metal mix, 40 mg tryptophan, 40 mg threonine, 40 mg lysine, 40 mg methionine, 15 mg kanamycin, 10 mg erythromycin The pH was adjusted to 7.4 by the addition of m hydrochloric acid Vitamin concentrate contained (per L) 20 mg pyridoxamine hydrochloride, 10 mg thiamine hydrochloride, 20 mg p-aminobenzoic acid, 20 mg calcium pantothenate, mg biotin, 10 mg folic acid, 15 mg nicotinic acid, 100 lg cyanocobalamine Trace metal mix contained (per L) 16.0 g MnCl2Ỉ4H2O, 1.5 g CuCl2Ỉ2H2O, 27.0 g of CoCl2Ỉ6H2O, 37.5 g FeCl3Ỉ6H2O, 3.3 g H3BO3, 8.4 g zinc acetate, 40.8 g sodium citrate, g EDTA Cultures were incubated at 32 °C with shaking At an optical density of 0.7–0.9 at 600 nm, isopropylthiob-d-galactopyranoside was added to a final concentration of mm, and incubation was continued for 10 h The cells were then harvested by centrifugation and stored at )20 °C Isolation of DNA photolyase DNA photolyase was prepared essentially as described previously [29] The ammonium sulphate precipitation step was performed after chromatography on Heparin Sepharose Enzyme concentration was monitored photometrically (e580 ¼ 4800 m)1cm)1) [47] Buffer exchange Samples were transferred into the desired buffer [usually containing 50 mm Hepes pH 7.0, 100 mm NaCl, 10 mm dithiothreitol, 50% (v ⁄ v) glycerol] by repeated dilution and ultrafiltration through C30 microconcentrators (Pall Gelman, Dreieich, Germany) at °C Experiments in D2O 1863 FT-IR on DNA photolyase were carried out at pH 7.0 (uncorrected glass electrode reading) The dilution ⁄ concentration cycle was repeated five times to give a final D2O enrichment of 95–99% Preparation of substrate A 4-mm solution of single-strand oligo-(dT)18 DNA was irradiated for 45 using a 254 nm G8W UV-lamp (Sylvania, Cordes, Delmenhorst, Germany) placed at a distance of cm The reaction was monitored photometrically (260 nm) Monitoring of enzyme activity Following the procedure developed by Jorns et al [36], the enzyme activity was measured by monitoring the repair of cyclobutane pyrimidine dimers by DNA photolyase as a function of time by using UV–vis spectroscopy UV-irradiated single-strand oligo-(dT)18 DNA was used as a substrate The photorepair was performed by illuminating the mixture with 365-nm light from a dual wavelength UV lamp, and the repair of the cyclobutane pyrimidine dimers by DNA photolyase was followed by changes of the absorption at 260 nm Monitoring of irradiation damage Aliquots (2–10 lL) of solutions containing photodamaged oligothymidine in water were mixed with lL m potassium phosphate buffer pH 7.0 and 30 lL 20 mm KMnO4 [48] and water was added to a final volume of 600 lL under an inert atmosphere at room temperature After min, the reaction mixture was centrifuged at 10 000 g for The integrated absorbance of the supernatant was monitored in the range 460–590 nm Reaction mixtures containing no oligonucleotide (100% yield) and undamaged DNA (0% yield) were used as references The consumption of KMnO4 is equivalent to undamaged thymidine Typically, about 50% of the bases were damaged as analysed by this method FT-IR sample preparation Stock solutions contained 1.2 mm DNA photolyase and mm DNA (native or damaged), respectively Equal volumes of the stock solutions were mixed as required for experiments Reaction mixtures were transferred into a cuvette equipped with calcium fluoride windows and a 5-lm spacer under a nitrogen atmosphere in the dark Prior to measurements, the samples were thermally equilibrated in the spectrometer FT-IR instrumentation FT-IR spectra were recorded with infrared spectrometers (IFS 66, 66 V, 66 VS or 88) from Bruker Instruments 1864 E Schleicher et al (Bremen, Germany) These instruments were all equipped with highly sensitive MCT-detectors and are similar in their optical layout, but are equipped with different light sources for irradiation of samples with visible or UV light Redlight irradiation was performed with a 100-W halogen lamp (Spindler & Hoyer, Gottingen, Germany) using an optical ă OG 530 lter (Schott, Mainz, Germany) Pulsed excimer lasers (LPX 240i, LPX 305, Lambda Physik, Gottingen, ă Germany) were used for irradiation at 308 nm in the evacuated IFS 66VS and 66 V spectrometers Sample irradiation was invariably performed inside the spectrometer in order to avoid physical handling of the cuvettes during IR experiments All spectra were recorded with a bandwidth of cm)1 Typically, 100 scans were accumulated and Fourier-transformed with the apodization function Happ–Genzel weak Acknowledgements This work was supported by the Deutsche Forschungsgemeinschaft (SFB-533, TP A5 and SFB-498, TP A2), by the Fonds der Chemischen Industrie and by the Hans-Fischer-Gesellschaft We thank Dr Chris Kay for stimulating discussions and Richard Feicht for excellent technical assistance References Friedberg EC (1995) DNA Repair and Mutagenesis ASM Press, Washington, D.C Sancar GB (1990) DNA photolyases–physical-properties, action mechanism, and roles in dark repair Mutation Res 236, 147–160 Blackburn GM & Davies RJH (1966) Structure of DNA-derived thymine dimer Biochem Biophys Res Commun 22, 704–706 Blackburn GM & Davies RJH (1965) Structure of thymine photo-dimer Chem Commun 215–216 Otoshi E, Yagi T, Mori T, Matsunaga T, Nikaido O, Kim ST, Hitomi K, Ikenaga M & Todo T (2000) Respective roles of cyclobutane pyrimidine dimers, (6–4) photoproducts, and minor photoproducts in ultraviolet mutagenesis of repair-deficient xeroderma pigmentosum A cells Cancer Res 60, 1729–1735 Todo T, Takemori H, Ryo H, Ihara M, Matsunaga T, Nikaido O, Sato K & Nomura T (1993) A new photoreactivating enzyme that specifically repairs ultraviolet light-induced (6–4) photoproducts Nature 361, 371–374 Nakajima S, Sugiyama M, Iwai S, Hitomi K, Otoshi E, Kim ST, Jiang CZ, Todo T, Britt AB & Yamamoto K (1998) Cloning and characterization of a gene (UVR3) required for photorepair of 6–4 photoproducts in Arabidopsis thaliana Nucleic Acids Research 26, 638–644 FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS E Schleicher et al Todo T (1999) Functional diversity of the DNA photolyase blue light receptor family Mutation Res-DNA Repair 434, 89–97 Miyamoto Y & Sancar A (1998) Vitamin B2-based blue-light photoreceptors in the retinohypothalamic tract as the photoactive pigments for setting the circadian clock in mammals Proc Natl Acad Sci USA 95, 6097–6102 10 Zhao SY & Sancar A (1997) Human blue-light photoreceptor hCRY2 specifically interacts with protein serine ⁄ threonine phosphatase and modulates its activity Photochem Photobiol 66, 727–731 11 Malhotra K, Kim ST, Batschauer A, Dawut L & Sancar A (1995) Putative blue-light photoreceptors from Arabidopsis thaliana and Sinapis alba with a high-degree of sequence homology to DNA photolyase contain the photolyase cofactors but lack DNA-repair activity Biochemistry 34, 6892–6899 12 Park HW, Kim ST, Sancar A & Deisenhofer J (1995) Crystal-structure of DNA photolyase from Escherichia coli Science 268, 1866–1872 13 Tamada T, Kitadokoro K, Higuchi Y, Inaka K, Yasui A, deRuiter PE, Eker APM & Miki K (1997) Crystal structure of DNA photolyase from Anacystis nidulans Nat Struct Biol 4, 887–891 14 Komori H, Masui R, Kuramitsu S, Yokoyama S, Shibata T, Inoue Y & Miki K (2001) Crystal structure of thermostable DNA photolyase: Pyrimidine-dimer recognition mechanism Proc Natl Acad Sci USA 98, 13560– 13565 15 Jorns MS, Baldwin ET, Sancar GB & Sancar A (1987) Action mechanism of Escherichia coli DNA photolyase Role of the chromophores in catalysis J Biol Chem 262, 486–491 16 Sancar GB, Jorns MS, Payne G, Fluke DJ, Rupert CS & Sancar A (1987) Action mechanism of Escherichia coli DNA photolyase Photolysis of the enzyme-substrate complex and the absolute action spectrum J Biol Chem 262, 492–498 17 Payne G, Heelis PF, Rohrs BR & Sancar A (1987) The active Form of Escherichia coli DNA photolyase contains a fully reduced flavin and not a flavin radical, both in vivo and in vitro Biochemistry 26, 7121– 7127 18 Sancar A (1996) No ‘end of history’ for photolyases Science 272, 48–49 19 Sancar A (2003) Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors Chem Rev 103, 2203–2237 20 Weber S (2005) Light-driven enzymatic catalysis of DNA repair: a review of recent biophysical studies on photolyase Biochim Biophys Acta 1707, 1–23 21 Li YF, Heelis PF & Sancar A (1991) Active-site of DNA photolyase – tryptophan-306 is the intrinsic hydrogen-atom donor essential for flavin radical photo- FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS FT-IR on DNA photolyase 22 23 24 25 26 27 28 29 30 31 32 33 reduction and DNA-repair in vitro Biochemistry 30, 6322–6329 Kim ST, Sancar A, Essenmacher C & Babcock GT (1993) Time-resolved EPR studies with DNA photolyase – excited-state FADH (0) abstracts an electron from Trp-306 to generate FADH–, the catalytically active form of the cofactor Proc Natl Acad Sci USA 90, 8023–8027 Heelis PF, Okamura T & Sancar A (1990) Excited-state properties of Escherichia coli DNA photolyase in the picosecond to millisecond time-scale Biochemistry 29, 5694–5698 Sancar GB, Smith FW & Sancar A (1985) Binding of Escherichia coli DNA photolyase to UV-irradiated DNA Biochemistry 24, 1849–1855 Kim ST & Sancar A (1991) Effect of base, pentose, and phosphodiester backbone structures on binding and repair of pyrimidine dimers by Escherichia coli DNA photolyase Biochemistry 30, 8623–8630 Kim ST, Heelis PF, Okamura T, Hirata Y, Mataga N & Sancar A (1991) Determination of rates and yields of interchromophore (folate fi flavin) energy-transfer and intermolecular (flavin fi DNA) electron-transfer in Escherichia coli photolyase by time-resolved fluorescence and absorption-spectroscopy Biochemistry 30, 11262– 11270 Kim ST & Sancar A (1993) Photochemistry, photophysics, and mechanism of pyrimidine dimer repair by DNA photolyase Photochem Photobiol 57, 895–904 Hamm-Alvarez S, Sancar A & Rajagopalan KV (1990) The folate cofactor of Escherichia coli DNA photolyase acts catalytically J Biol Chem 265, 18656–18662 Kay CWM, Feicht R, Schulz K, Sadewater P, Sancar A, Bacher A, Mobius K, Richter G & Weber S (1999) ¨ EPR, ENDOR, and TRIPLE resonance spectroscopy on the neutral flavin radical in Escherichia coli DNA photolyase Biochemistry 38, 16740–16748 Jorns MS, Wang BY, Jordan SP & Chanderkar LP (1990) Chromophore Function and interaction in Escherichia coli DNA photolyase – Reconstitution of the apoenzyme with pterin and or flavin derivatives Biochemistry 29, 552–561 Weber S, Richter G, Schleicher E, Bacher A, Mobius K ă & Kay CWM (2001) Substrate binding to DNA photolyase studied by electron paramagnetic resonance spectroscopy Biophys J 81, 1195–1204 Payne G & Sancar A (1990) Absolute action spectrum of E-FADH2 and E-FADH2-MTHF forms of Escherichia coli DNA photolyase Biochemistry 29, 7715– 7727 Murgida DH, Schleicher E, Bacher A, Richter G & Hildebrandt P (2001) Resonance Raman spectroscopic study of the neutral flavin radical complex of DNA photolyase from Escherichia coli J Raman Spectroscopy 32, 551–556 1865 FT-IR on DNA photolyase 34 Schelvis JPM, Ramsey M, Sokolova O, Tavares C, Cecala C, Connell K, Wagner S & Gindt YM (2003) Resonance Raman and UV-Vis spectroscopic characterization of FADH in the complex of photolyase with UV-damaged DNA J Phys Chem B 107, 12352– 12362 35 Schmitz M, Tavan P & Nonella M (2001) Vibrational analysis of carbonyl modes in different stages of lightinduced cyclopyrimidine dimer repair reactions Chem Physics Lett 349, 342–348 36 Jorns MS, Sancar GB & Sancar A (1985) Identification of Oligothymidylates as new simple substrates for Escherichia coli DNA photolyase and their use in a rapid spectrophotometric enzyme assay Biochemistry 24, 1856–1861 37 Banyay M, Sarkar M & Graslund A (2003) A library of IR bands of nucleic acids in solution Biophys Chem 104, 477–488 38 Husain I, Griffith J & Sancar A (1988) Thymine dimers bend DNA Proc Natl Acad Sci USA 85, 2558–2562 39 McAteer K, Jing Y, Kao J, Taylor JS & Kennedy MA (1998) Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer, the major UV photoproduct of DNA J Mol Biol 282, 1013–1032 40 Park H, Zhang K, Ren Y, Nadji S, Sinha N, Taylor JS & Kang C (2002) Crystal structure of a DNA decamer containing a cis-syn thymine dimer Proc Natl Acad Sci USA 99, 15965–15970 41 Husain I, Sancar GB, Holbrook SR & Sancar A (1987) Mechanism of damage recognition by Escherichia coli DNA photolyase J Biol Chem 262, 13188–13197 42 Vande Berg BJ & Sancar GB (1998) Evidence for dinucleotide flipping by DNA photolyase J Biol Chem 273, 20276–20284 43 Torizawa T, Ueda T, Kuramitsu S, Hitomi K, Todo T, Iwai S, Morikawa K & Shimada I (2004) Investigation of the cyclobutane pyrimidine dimer (CPD) photolyase DNA recognition mechanism by NMR analyses J Biol Chem 279, 32950–32956 1866 E Schleicher et al 44 Mees A, Klar T, Gnau P, Hennecke U, Eker APM, Carell T & Essen L-O (2004) Crystal structure of a photolyase bound to a CPD-like DNA lesion after in situ repair Science 306, 1789–1793 45 Marini F III, Naeem A & Lapeyre JN (1993) An efficient 1-tube PCR method for internal site-directed mutagenesis of large amplified molecules Nucleic Acids Research 21, 2277–2278 46 Williams DM, Duvall EJ & Lovett PS (1981) Cloning restriction fragments that promote expression of a gene in Bacillus subtilis J Bacteriol 146, 1162–1165 47 Wang BY & Jorns MS (1989) Reconstitution of Escherichia coli DNA photolyase with various folate derivatives Biochemistry 28, 1148–1152 48 Ramaiah D, Koch T, Orum H & Schuster GB (1998) Detection of thymine [2+2] photodimer repair in DNA: selective reaction of KMnO4 Nucleic Acids Research 26, 3940–3943 49 Zamenhof PJ & Villarej M (1972) Construction and properties of Escherichia coli strains exhibiting alphacomplementation of beta-galactosidase fragments in vivo J Bacteriol 110, 171–178 50 Stuber D, Matile H & Garotta G (1990) System for ă high-level production in Escherichia coli and rapid purification of recombinant proteins: application to epitope mapping, preparation of antibodies, and structure-function analysis In Immunological Methods IV (Lefkovits, I & Pernis, P, eds), pp 121–152 Academic Press, Orlando, Florida 51 Bullock WO, Fernandez JM & Short JM (1987) Xl1Blue–a high-efficiency plasmid transforming RecA Escherichia coli strain with beta-galactosidase selection BioTechniques 5, 376–380 52 Richter G, Fischer M, Krieger C, Eberhardt S, Luttgen H, Gerstenschlager I & Bacher A (1997) Biosynthesis of riboflavin: Characterization of the bifunctional deaminase-reductase of Escherichia coli and Bacillus subtilis J Bacteriol 179, 2022–2028 53 Le Grice SF (1990) Regulated promoter for high-level expression of heterologous genes in Bacillus subtilis Methods Enzymol 185, 201–214 FEBS Journal 272 (2005) 1855–1866 ª 2005 FEBS ... difference spectra of DNA photolyase and DNA (A) Oligo-(dT)18 DNA photodamage with UV radiation in the absence of photolyase (B) Photoreactivation of DNA photolyase followed by DNA photorepair (after... an elucidation of a detailed molecular picture of the light-driven DNA repair process Results Construction of a DNA photolyase E109A mutant MTHF, the second cofactor of E coli DNA photolyase, acts... photoreduction of the flavin semiquinone radical 1857 FT-IR on DNA photolyase Fig FT-IR difference spectra of DNA photolyase (A, A¢) Photoreduction of DNA photolyase (two different batches of protein)