The genes of two g proteins involved in protein transport in pichia pastoris

Biochemical and Biophysical Research Communications 280, 454 – 459 (2001) doi:10.1006/bbrc.2000.4138, available online at http://www.idealibrary.com on The Genes of Two G-Proteins Involved in Protein Transport in Pichia pastoris Trang Thi Ngoc Huynh, Randi Vad, Tom Kristensen, and Tordis B Øyen Department of Biochemistry, University of Oslo, P.O Box 1041 Blindern, 0316 Oslo, Norway Received December 7, 2000 Members of the Rab protein family play essential roles in vesicle fusion during protein secretion and represent highly conserved GTP binding proteins The Saccharomyces cerevisiae Sec4p and Ypt1p, promoting vesicle fusion at the plasma membrane and in ERGolgi transport, respectively, are among the best characterised yeast members We have here cloned the Pichia pastoris SEC4 homologue using a S cerevisiae SEC4 probe In addition we isolated a crosshybridising clone encoding another Rab-/Ypt-like protein The deduced full-length PpSec4p comprises 204 amino acid residues with an over all identity of 64% to the Sec4p from S cerevisiae and 72% to the Candida albicans Sec4p The YPT-like gene encodes a 216 amino acid residue protein showing highest similarity to the S cerevisiae Ypt10p and Ypt53p Both PpSec4p and the Ypt-like protein carry a ؊Cys-Cys C-terminus, indicating that these proteins are targets for geranylgeranylation by a type II prenyltransferase © 2001 Academic Press The methylotrophic yeast Pichia pastoris has lately become one of the most popular hosts for production of recombinant proteins, as exemplified by a summary of numerous successful cases in a recent review (1) The majority of the referred examples concern heterologous proteins that have been secreted to the growth medium of P pastoris In some cases exceptionally high yields have been obtained, such as for human serum albumin (1, 2) and recombinant murine gelatines (3) Whether efficient secretion can be related to special features of the secretory pathway is not known Though it is known that, compared to that of S cerevisiae, the secretory pathway of P pastoris is somewhat differently organised with Golgi cisternae formed as stacks and with apparently discrete exit regions for transport vesicles from the endoplasmic reticulum (4) On the other hand, proteins involved display an expected high degree of identity between the two yeasts A recent report (5) on the isolation and sequencing of the P pastoris 0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved genes homologous to SEC12, SEC13, SEC17, SEC18, and SAR1, genes that are involved in the ER-to-Golgi transport, shows that the derived amino acid sequences are strongly conserved for all the proteins except for the transmembrane ER protein Sec12p, which carries a larger luminal domain in the methylotrophic yeast Nonetheless, all the reported SECgenes were obtained by complementation of temperature sensitive mutations in S cerevisiae (5) Generally however, basic knowledge of P pastoris is still limited, and few genes are so far known by sequence The main purpose of the present work was to get more information about components at the end of the secretory pathway in P pastoris The Sec4p belongs to the Rab family of GTP binding proteins and is essential for targeting the secretory vesicles to the plasma membrane (reviewed in (6)) During this process the Sec4p is anchored to the vesicle membrane, and to the plasma membrane after vesicle docking, through a geranylgeranylated C-terminus (6) A multiprotein complex called the exocyst, which contains one copy each of Sec3p, Sec5p, Sec6p, Sec8p, Sec15p and Exo70, is also essential for exocytosis (7) The Sec3p component is proposed to specify sites for exocytosis at the bud tip plasma membrane (8), while the Sec15p specifically interacts with GTP-activated Sec4p on vesicles to direct vesicle docking, and Sec4p may thereby even assist in assembly of the other exocyst components onto Sec3p (9) Hence, Sec4p plays a central role in exocytosis It is one member of a total of eleven Ypt/RabGTPases that share characteristic features and seem to be involved in vesicular transport in S cerevisiae (10) Sec4p shows from 32 to 49% sequence identity to the other members We have here used a S cerevisiae SEC4-probe to isolate the P pastoris homologue, and due to the conserved nature, it was expected that genes for other Ypt-like GTPases might be found as well The results show that PpSEC4 could be identified unambiguously on an assembled sequence of 3.2 kb A divergently transcribed gene encoding part of a phenylalanyl-tRNA synthetase subunit was identified on the same fragment Another clone of 1.6 kb that 454 Vol 280, No 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS FIG Schematic representation of cloned genomic fragments encoding P pastoris SEC4 with selected restriction sites (Bg, BglII; H, HindIII; K, KpnI; RI, EcoRI; P, PstI) (A) 2033 bp HindIII-fragment Underlined K-H fragment indicates probe used (B) Overlapping 2409 bp BglII fragment (C) Open reading frames in the 3175 bp assembled sequence shown as open boxes with arrows indicating direction of transcription: PpFRS1 from position 1126 to upstream of position 1, PpSEC4 from 1571 to 2182, and a potential frame from 2805 and beyond 3175 with a possible upstream intron (IVS, filled box) from position 2368 to 2666 The 444 bp indicates distance between translational start codons of PpFRS1 and PpSEC4 gave hybridisation signal with the SEC4-probe was found to encode a Ypt-like protein, probably also involved in vesicle transport, together with part of a potential protein kinase MATERIALS AND METHODS Materials Hybond-Nϩ nylon membranes, Hyperfilm, [␣- 32P]dATP, Megaprime labelling system, and Thermo Sequenase fluorescent labelled primer cycle sequencing kit were from Amersham Pharmacia Biotech Enzymes used were from MBI Fermentas or GibcoBRL, kits for extraction of DNA from agarose gel and for purification of plasmids and PCR products were from QIAGEN, and oligonucleotide primers for PCR and sequencing were ordered from Eurogentec, Bel S A The Pichia pastoris strain GS115 was kindly provided by Philips Petroleum and E coli strain DH5␣ purchased from GibcoBRL Culture media components were from Difco Laboratories Preparation of DNA, hybridisation and cloning Genomic yeast DNA was isolated and purified on CsCl gradients essentially as described (11) Aliquots of P pastoris DNA were digested with restriction enzymes that cut once in pUC19, subjected to agarose gel electrophoresis and blotted onto membrane filters A 621-bp SEC4fragment was amplified from genomic S cerevisiae DNA by PCR using the primer set 5Ј-GAACTGT TTCTGCTTCA TCCGG/5ЈATTTAGAACTGTTTCCGCTCC The product was purified and labelled using [␣- 32P]dATP in a random priming reaction Low stringency hybridisation was carried out at 55–58°C with 150 –200,000 cpm probe per ml in 0.2% Ficoll 400, 0.2% polyvinylpyrrolidone, 0.2% bovine albumin, M NaCl, 2.2 mM Na P 2O 7, 1% sodium dodecyl sulphate and 50 mM Tris-HCl, pH 7.5 Restriction fragments from selected size areas were purified from agarose gels and ligated into pUC19 Competent E coli DH5␣ cells (12) were transformed to generate pUC19-based restriction fragment size-libraries Plasmids were propagated in the same strain DNA sequencing and sequence analyses Automatic DNAsequencing was performed on an ALFexpress DNA Sequencer (Pharmacia Biotech) Cycle sequencing reactions were set up with the Thermo Sequenase system and Cy5-labelled primers complementary to flanking vector sequences Fragment assembly was performed using Fragment Assembly programs in the GCG package (Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, WI) Complete sequences were obtained after proper subcloning based on existing restriction sites Access to the Saccharomyces Genome Database was made through the Stanford Genomic Resources (http://genome-www.stanford.edu/Saccharomyces/) A multiple alignment of selected entries from SWALL was constructed using ClustalW with the Gonnet scoring matrix, a gap opening penalty of 10 and a gap extension penalty of 0.05 The alignments were visualised using the GeneDoc program Sequences described in this work have been submitted to the EMBL Nucleotide Sequence Database with Accession Nos AJ304407 (PpSEC4) and AJ304408 (PpYPT-like gene) RESULTS Isolation of the P pastoris SEC4 Gene from Restriction Fragment Size Libraries A clear hybridisation signal at about kb was detected when blots of HindIII-treated genomic DNA of P pastoris GS115 were incubated with the S cerevisiae SEC4-probe A HindIII-fragment library in the size range from about 1.5 to 2.5 kb was then constructed and screened with the SEC4-probe A positive clone with a 2-kb insert was analysed (Fig 1A) Sequencing followed by database searches revealed two incomplete divergently oriented open reading frames, the largest encoding the N-terminal two thirds (375 AA) of the homologue of the ␣-subunit of S cerevisiae phenylalanyl tRNA synthetase (FRS1) and the other about three quarters of the wanted SEC4 gene To find the remaining part, a size-library covering from to kb BglIIfragments in the BamHI-site in pUC19 was constructed and screened for SEC4-sequences using a small KpnI–HindIII fragment from the kb HindIIIclone as probe (marked in Fig 1A) A 2.4 kb overlapping BglII fragment (Fig 1B) was isolated and found to comprise the full length PpSEC4 together with part of another potential open reading frame that encodes a so far unidentified protein, preceded by a 299-nucleotide long intron with GTAAGT, TACTAAC and AAT representing 5Ј splice-, branchpoint- and 3Ј splice-sequence, 455 Vol 280, No 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS FIG Alignment of amino acid sequences of Sec4p homologues from different yeasts together with the S cerevisiae Ypt1-protein Identical sequences allowing some conserved substitutions are displayed on black background, and different grey shadings indicate identity in three to four of the aligned sequences respectively (5) Figure 1C illustrates the position and direction of the open reading frames on the 3175 bp assembled sequence Searches in the Saccharomyces Genomic Database with both nucleotide- and amino acid sequence gave higher score for Sec4p than for other members of the Rab-GTPases Alignment of the amino acid sequence of PpSec4p and those for Sec4p from S cerevisiae, Candida albicans (13, 14) and Schizosaccharomyces pombe (SpYpt2p) (15) is shown in Fig where also the sequence of ScYpt1p is included for comparison The calculated sequence identities and similarities from the alignment are summarised in Table It is seen that 70% of the residues in CaSec4p are identical to the PpSec4p sequence, somewhat less for ScSec4p and SpYpt2p, while the identity of Ypt1p is significantly lower, 46% Altogether this indicates that we have cloned the SEC4 gene of P pastoris A large part (Fig 2) of PpSec4p represents highly conserved domains encompassing the sequence motifs for nucleotide binding and reactive centre (10) The –Cys-Cys C-terminus is also conserved and indicates that PpSec4p can be anchored to membranes through geranyl-geranylation by a type II prenyltransferase similar to the Bet1p-Bet4p which modifies Sec4p and other S cerevisiae proteins terminating with –Cys-Cys or –Cys-X-Cys (16 –18) Characterisation of a Crosshybridising Clone Encoding a Small G-Protein Due to the high similarity between members of the Rab-family and to other small GTPases involved in TABLE Comparison of Amino Acid Sequences of Yeast Sec4 Proteins to the P pastoris Sec4p Homologue SpSec4p PpSec4p CaSec4p ScSec4p (ϭSpYpt2) ScYpt1p Amino acid residues % Identity % Similarity 204 — — 210 70 83 215 60 77 200 59 75 206 46 64 Note Percent identity and similarity calculated from the alignment in Fig 456 Vol 280, No 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS FIG P pastoris Ypt-like protein (A) Schematic representation of the cloned 1677 bp HindIII fragment (H, HindIII; S, SalI) The arrows show direction of the two open reading frames (open boxes) The frame encoding the Ypt-like protein goes from position 122 to 769 The other, encoding a potential protein kinase, goes in the opposite direction from beyond the end of the fragment to position 762, giving a short overlap between the two frames (B) Alignment of the deduced amino acid sequence for the Ypt-like protein, PpG-prot, and the S cerevisiae Ypt10p and Ypt53p sequences, displayed as in Fig protein transport, it was expected that the ScSEC4probe could hybridise also to related sequences at the conditions used In our case, such clones would be limited to the size-range for the analysed restriction fragment libraries The screening resulted in one additional clone with a 1677 bp HindIII-fragment insert (Fig 3A) which was found to encode the full length of a 216 amino acid residue Ypt-like G-protein Another open reading frame that goes the opposite direction from beyond the end of the sequence and overlaps with two codons plus stop codon with the end of the G-protein gene, encodes the C-terminal part (305 AA) of a potential Ser/Thr protein kinase No consensus intron sequences were found in this clone In Fig 3B the deduced amino acid sequence of the G-protein is compared to the sequence of the S cerevisiae Yptproteins, ScYpt10 and ScYpt53 that gave highest score upon homology searches The calculated identities and similarities are, respectively, 39% and 59% for Ypt10p (218 AA) and 34% and 50% for Ypt53p (220 AA), and all consensus motifs for nucleotide binding (10) are present This is also evident when sequence motifs for the Ypt-like G-protein and PpSec4p are compared (Table 2) Furthermore, the two cysteins at the C-terminus indicate that the P pastoris G-protein is another target for lipid modification (16, 17) with possible membrane attachment as for Sec4p This new G-protein might therefore be involved in vesicle transport as well However, the identity of the Ypt-like protein is difficult to decide from sequence alone because several yeast Yptproteins show from 35 to 42% identity in conserved regions DISCUSSION P pastoris is now widely used as a host for production and secretion of heterologous proteins (1) It is therefore important to generate more basic knowledge about this yeast, especially to get a better understanding of the secretory pathway Five genes encoding proteins involved in the ER-to-Golgi transport are already known (5), and in the present work, we have charac- 457 Vol 280, No 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE Comparison of Conserved Motifs G1-G5 and C-Terminus (10) in PpSec4p and the Ypt-like Protein PpG-prot PpSec4p PpG-prot G1 G2 G3 G4 G5 C-terminus 21-GDSGVGKS 32-GESAVGKS 43-FITTIGIDF 54-KESTIGAAF 68-WDTAGQE 85-WDTAGQE 126-GNKCD 145-GNKSD 153-FLEASAK 170-YFKTSAK 201-SSCC 213-SSCC Note The numbers show the start position of each sequence motif Identities are in bold letters terised two genes belonging to the Rab family, one encoding the P pastoris homologue of the Sec4p and one that encodes another Ypt-like GTP-binding protein The amino acid sequence of PpSec4p matches nicely to other yeast Sec4p sequences with conservation of regions spanning domains involved in nucleotide binding and hydrolysis More variable regions are found at the N-terminal end and especially, in the C-terminal half (Fig 2), which may be reflected in corresponding variations in collaborating proteins Also the Ypt-like protein (Fig 3B) fulfils the criteria of a Rab-protein that can be attached to membranes by geranyl-geranylation of the C-terminus Based on the observed similarities, we suggest that this new G-protein functions somewhere in vesicle transport The Rab proteins represent a subfamily of the Ras superfamily of GTP/GDP-binding eukaryotic proteins, and the function in control of vesicle trafficking is linked to activation of the intrinsic GTPase activity resulting in hydrolysis of GTP accompanied with conformational changes as a driving force (10, 19, 20) The process, including recycling followed by regeneration of the active forms, requires sequential interactions of the Rab protein with several other proteins A balanced ratio between the many actors in the secretory pathway (6) may therefore be critical for normal growth In fact, toxic effects have been observed upon overexpression of YPT10 in S cerevisiae, apparently due to alteration of structures in the Golgi apparatus (21) On the other hand, overproduction of wild-type Sec4p in C albicans did not affect growth, while mutant forms behave as dominant-negative alleles (6, 14, 22) The complexity of the secretory pathway is further accentuated by the possible existence of parallel secretory routs to the cell surface in yeast (23) How the cells then handle a situation of overexpression and secretion of heterologous proteins is poorly understood Rate limiting steps may arise during folding in the ER for some proteins, or during vesicle fusion at the plasma membrane for others, but we not know whether Sec4p could be a limiting factor under any circumstances Though, knowledge of the genes specifying components in the secretory pathway is essential for studies on regulation and further, to find how the efficiency of secretion can be controlled REFERENCES Cereghino, J L., and Cregg, J M (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris FEMS Microbiol Rev 24, 45– 66 Sreekrishna, K., Tschopp, J F., Thill, G P., Brierley, R A., and Barr, K A (1998) Expression of human serum albumin in Pichia pastoris US Patent No 5,707,828 Werten, M W T., van den Bosch, T J., Wind, R D., Mooibroek, H., and de Wolf, F A (1999) High-yield secretion of recombinant gelatins by Pichia pastoris Yeast 15, 1087–1096 Rossanese, O W., Soderholm, J., Bevis, B J., Sears, I B., O’Connor, J., Williamson, E K., and Glick, B S (1999) Golgi structure correlates with transitional endoplasmic reticulum organization in Pichia pastoris and Saccharomyces cerevisiae J Cell Biol 145, 69 – 81 Payne, W E., Kaiser, C A., Bevis, B J., Soderholm, J Fu, D., Sears I B., and Glick, B S (2000) Isolation of Pichia pastoris genes involved in the ER-to-Golgi transport Yeast 16, 979 –993 Kaiser, C A., Gimeno, R E., and Shaywitz, D A (1997) Protein secretion, membrane biogenesis, and endocytosis In The Molecular and Cellular Biology of the Yeast Saccharomyces: Cell Cycle and Cell Biology (Pringle, J R., Broach, J R., and Jones, E W., Eds.), Vol 3, pp 91–227, Cold Spring Harbor Laboratory Press, NY TerBush, D R., Maurice, T., Roth, D., and Novick, P (1996) The exocyst is a multiprotein complex required for exocytosis in Saccharomyces cerevisiae EMBO J 15, 6483– 6494 Finger, F P., Hughes, T E., and Novick, P (1998) Sec3p is a spatial landmark for polarized secretion in budding yeast Cell 92, 559 –571 Guo, W., Roth, D., Walch-Solimena, C., and Novick, P (1999) The exocyst is an effector for Sec4p, targeting secretory vesicles to sites of exocytosis EMBO J 18, 1071–1080 10 Lazar, T., Goătte, M., and Gallwitz, D (1997) Vesicular transport: How many Ypt/Rab-GTPases make a eukaryotic cell? Trends Biochem Sci 22, 468 – 472 11 Harbitz, I., and Øyen, T B.(1974) Study of a haploid yeast strain with an unusually high rDNA content I Comparison of hybridisation levels after purification of the DNA by different methods Biochim Biophys Acta 366, 374 –384 12 Hanahan, D (1985) Techniques for transformation of E coli In DNA Cloning: A Practical Approach (Glover, D M., Ed.), Vol I, pp 109 –135, IRL Press Ltd., Oxford 13 Cle´ment, M., Fournier, H., de Repentigny, L., and Belhumeur, P (1998) Isolation and characterisation of the Candida albicans SEC4 gene Yeast 14, 675– 680 14 Mao, Y., Kalb, V F., and Wong, B (1999) Overexpression of a dominant-negative allele of SEC4 inhibits growth and protein secretion in Candida albicans J Bacteriol 181, 7235–7242 15 Haubruck, H., Engelke, U., Mertins, P., and Gallwitz, D (1990) Structural and functional analysis of ypt2, an essential ras- 458 Vol 280, No 2, 2001 16 17 18 19 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS related gene in the fission yeast Schizosaccharomyces pombe encoding a Sec4 protein homologue EMBO J 9, 1957–1962 Rossi, G., Jiang, Y., Newman, A P., and Ferro-Novick, S (1991) Dependence of Ypt1 and Sec4 membrane attachment on Bet2 Nature 351, 158 –161 Li, R., Havel, C, Watson, J A., and Murray, A W (1993) The mitotic feedback control gene MAD2 encodes the ␣-subunit of a prenyltransferase Nature 366, 82– 84 Jiang, Y., Rossi, G., and Ferro-Novick, S (1993) Bet2p and Mad2p are components of a prenyltransferase that adds geranylgeranyl onto Ypt1p and Sec4p Nature 366, 84 – 86 Valencia, A., Chardin, P., Wittinghofer, A., and Sander, C (1991) The ras protein family: Evolutionary tree and role of conserved amino acids Biochemistry 30, 4637– 4648 20 Garcia-Ranea, J A., and Valencia, A (1998) Distribution and functional diversification of the ras superfamily in Saccharomyces cerevisiae FEBS Lett 434, 219 –225 21 Louvet, O., Roumanie, O., Barthe, C., Peypouquet, M.-F., Schaeffer, J., Doignon, F., and Crouzet, M (1999) Characterization of the ORF YBR264c in Saccharomyces cerevisiae, which encodes a new yeast Ypt that is degraded by a proteasome-dependent mechanism Mol Gen Genet 261, 589 – 600 22 Grote, E., and Novick, P J (1999) Promiscuity in Rab-SNARE interactions Mol Biol Cell 10, 4149 – 4161 23 Harsay, E., and Bretscher, A (1995) Parallel secretory pathways to the cell surface in yeast J Cell Biol 131, 297–310 459 ... transport The Rab proteins represent a subfamily of the Ras superfamily of GTP/GDP-binding eukaryotic proteins, and the function in control of vesicle trafficking is linked to activation of the. .. another Ypt-like GTP-binding protein The amino acid sequence of PpSec4p matches nicely to other yeast Sec4p sequences with conservation of regions spanning domains involved in nucleotide binding... encoding the Ypt-like protein goes from position 122 to 769 The other, encoding a potential protein kinase, goes in the opposite direction from beyond the end of the fragment to position 762, giving