Fluorescent microsphere based readout technology for multiplexed human single nucleotide polymorphism analysis and bacterial identification

HUMAN MUTATION 17:305–316 (2001) METHODS Fluorescent Microsphere-Based Readout Technology for Multiplexed Human Single Nucleotide Polymorphism Analysis and Bacterial Identification Fei Ye,1* May-Sung Li,1 J David Taylor,1 Quan Nguyen,2 Heidi M Colton,3 Warren M Casey,3 Michael Wagner,2 Michael P Weiner,1 and Jingwen Chen1 Department of Genomic Sciences, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina Department of Human Genetics, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina Department of Analytical Sciences, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina For the SNP 2000 Special Issue Large-scale human genotyping requires technologies with a minimal number of steps, high accuracy, and the ability to automate at a reasonable cost In this regard, we have developed a rapid, cost-effective readout method for single nucleotide polymorphism (SNP) genotyping that combines an easily automatable single-tube allele-specific primer extension (ASPE) with an efficient high throughput flow cytometric analysis performed on a Luminex 100™ flow cytometer This robust technique employs an ASPE reaction using PCR-derived target DNA containing the SNP and a pair of synthetic complementary capture probes that differ at their 3¢ end-nucleotide defining the alleles Each capture probe has been synthesized to contain a unique 25-nucleotide identifying sequence (ZipCode) at its 5¢ end An array of fluorescent microspheres, covalently coupled with complementary ZipCode sequences (cZipCodes), was hybridized to biotin-labeled ASPE reaction products, sequestering them for flow cytometric analysis ASPE offers both an advantage of streamlining the SNP analysis protocol and an ability to perform multiplex SNP analysis on any mixture of allelic variants All steps of the assay are simple additions of the solutions, incubations, and washes This technique was used to assay 15 multiplexed SNPs on human chromosome 12 from 96 patients Comparison of the microsphere-based ASPE assay results to gel-based oligonucleotide ligation assay (OLA) results showed 99.2% agreement in genotype assignments In addition, the microsphere-based multiplex SNPs assay system was adapted for the identification of bacterial samples by both ASPE and single base chain extension (SBCE) assays A series of probes designed for different variable sites of bacterial 16S rDNA permitted multiplex analysis and generated species- or genus-specific patterns Seventeen bacterial species representing a broad range of gram-negative and gram-positive bacteria were analyzed within 16 variable sites of 16S rDNA sequence The results were consistent with the published sequences and confirmed by direct DNA sequencing Hum Mutat 17:305–316, 2001 © 2001 Wiley-Liss, Inc KEY WORDS: SNP; allele-specific primer extension; ASPE; single base chain extension; SBCE; microspheres; multiplex; flow cytometry; bacterial identification; mutation detection; ZipCode INTRODUCTION As the DNA sequence of the human genome is completely elucidated, much attention is being focused on single nucleotide polymorphisms (SNPs), the most abundant form of genetic variation According to some estimates, the human © 2001 WILEY-LISS, INC Received 18 October 2000; accepted revised manuscript January 2001 *Correspondence to: Fei Ye, Department of Genomic Sciences, GlaxoWellcome Research and Development, Moore Drive, Research Triangle, NC 27709-3398 306 YE ET AL genome may contain >3 million SNPs [Cooper et al., 1985] Due to their frequency and distribution, SNPs are becoming superior genetic markers for assembly of a high-resolution map, aiding identification of disease-related loci [Lai et al., 1998] In addition, SNPs can potentially be used for medical diagnostics The powerful, target-specific pharmaceuticals being developed today can bring profound improvements to the lives of many patients, but may have serious side effects in certain sub-populations The genetic variation behind these differing biological responses may correlate with a small set of SNPs that could serve as a diagnostic tool to insure prescription of the right medicine to the right patient These facts increase the need for high throughput genotyping technologies with simple steps and the ability to automate Recently, a number of methods for SNP detection have been developed, including restriction fragment length polymorphism (RFLP) analysis, single-strand conformation polymorphism analysis (SSCP) [Orita et al., 1989], allele-specific oligonucleotide hybridization (ASO) [Saiki et al., 1989], oligonucleotide ligation assay (OLA) [Landegren et al., 1988], primer extension assay [Syvanen, 1999; Pastinen et al., 1997], Taqman [Livak et al., 1995], molecular beacons [Tyagi et al., 1998], and structure-specific flp nuclease technology [Mein et al., 2000] A variety of platforms have been used to analyze reaction products including gel electrophoresis, fluorescence polarization [Chen et al., 1999], semiconductor chips [Gilles et al., 1999], high-density oligonucleotide arrays [Fan et al., 2000; Pastinen et al., 2000], and mass spectrometry [Fu et al., 1998; Ross at al., 1998] We have adapted the use of fluorescent microspheres in flow cytometric analysis [McHugh, 1994; Fulton et al., 1997; McDade and Fulton, 1997; Kettman et al., 1998] for SNP determination Previously we demonstrated the proof-ofconcept for this SNP-detection platform using FACS Calibur instrumentation for analysis of OLA [Iannone et al., 2000] and single base chain extension [Chen et al., 2000] assays A similar approach has also been reported recently [Cai et al., 2000] Here we describe a new SNPs assay that combines a DNA polymerase reaction named allele-specific primer extension (ASPE) with a microsphere-based detection using a less expensive flow cytometer with a 96-well plate reader The assay relies on the sequence-specific primer extension of two allele-specific capture oligonucleotide probes that differ at their 3′-end nucleotide defining the alleles A DNA sequence (termed ZipCode) at the 5′-end portion of the capture probe allows the resulting enzymatic reaction product to be captured by its complementary sequence (cZipCode), which has been coupled to a specific fluorescent microsphere The ASPE assay permits multiplexed querying of different nucleotides, thereby allowing multiplexing of both alleles of a particular SNP In this study, we demonstrate that this new readout system is a simple and reliable method that can be used for high throughput SNP genotyping To explore the applications of our microsphere-based multiplexed SNP assay, we have also adapted this assay system for rapid bacterial identification using 16S rDNA sequence The assay uses primers that are placed 5′ upstream of variable bases in the 16S rDNA sequence These primers are coupled with uniquely identifying sequences termed ZipCodes that are complementary to sequences (cZipCodes) covalently attached to fluorescent microspheres In our study, ASPE or single base chain extension (SBCE) was used to extend the primers with biotin-labeled dCTP or ddNTPs, respectively The reaction products were hybridized to the cZipCode-microsphere complex and analyzed by flow cytometry The flow cytometer identified the fluorescent microsphere and measured the presence of the biotin-labeled dCTP or ddNTP after tagging with streptavidin-phycoerythrin (SA-PE) The dCTP or ddNTP molecules added to the specific primers form a pattern which was analyzed to determine the bacterial identification Using this multiplexed assay, seventeen species were divided into seventeen groups based on their ASPE or SBCE reaction patterns MATERIALS AND METHODS Reagents Shrimp alkaline phosphatase (SAP) and E coli Exonuclease I (Exo I) were obtained from Amersham Pharmacia (Cleveland, OH) Biotinlabeled ddNTPs and biotin-labeled dCTP were FLUORESCENT MICROSPHERE FOR SNP ANALYSIS obtained from NEN Life Science Products, Inc (Boston, MA) AmpliTaq, AmpliTaq Gold Taq, and AmpliTaq FS DNA polymerases were purchased from Applied Biosystems (Foster City, CA) Taq FS DNA polymerase was obtained from Applied Biosystems as a special order Platinum GenoTYPE Tsp DNA polymerase was purchased from Gibco/BRL (Rockville, MD) Streptavidin-phycoerythrin (SA-PE) was obtained from Molecular Probes (Eugene, OR) Oligonucleotides with 5′ amino groups were ordered from Applied Biosystems 2-[N-Morpholino]ethanesulfonic acid (MES) and 1-Ethyl3-(3-Dimethylaminopropyl)carbodiimide Hydrochloride (EDC) were purchased from Sigma (St Louis, IL) and Pierce (Rockford, IL), respectively Carboxylated fluorescent polystyrene microspheres were purchased from Luminex Corporation (Austin, TX) PCR Amplification PCR reactions were performed in a 96-well microtiter-plate on a PTC-100 thermal cycler (MJ Research, Waltham, MA) 15 µl of reaction mixture contained 20 ng genomic DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 100 µM dNTPs, 0.2 µM of each primer, and 1.5 units of AmpliTaq Gold DNA polymerase The reactions included a 10 incubation at 95°C, followed by 40 cycles at 94°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec After cycling, the reactions were incubated at 72°C for a final extension of To clean up the PCR reaction for SBCE reaction, one unit of SAP and two units of Exo I were added to each 10 µl of the pooled PCR products The mixture was incubated at 37°C for 30 min, followed by 15 at 80°C to inactivate the enzymes Coupling of Oligonucleotides to Microspheres Oligonucleotides used for coupling to microspheres were designed according to our previous publications [Chen et al., 2000; Iannone et al., 2000] All of these oligonucleotides contain four elements: i) a 5′ amino group for covalent attachment to the carboxylated microsphere surface, ii) an 18-atom spacer (CH3CH2O)6 to minimize potential interaction between the oligonucleotide sequence and the microsphere surface, iii) a 10- 307 base LUCtag sequence (CAGGCCAAGT) to monitor the coupling efficiency of the oligonucleotides to the microspheres, and iv) one of a set of 25-base complementary ZipCode sequences (cZipCodes) This set of cZipCodes was selected from the Mycobacterium tuberculosis genome and was checked empirically for absence of cross-hybridization between members of the set [Iannone et al., 2000] For the coupling of oligonucleotides to microspheres, x 106 carboxylated microspheres in 50 µl of 0.1 M MES buffer were mixed with nmoles (2 µl of a mM solution) aminomodified oligonucleotide 10 µl of freshly made EDC (30 mg/ml in water) was added to the microsphere/oligo mixture and incubated at room temperature for 30 One additional fresh 10 µl aliquot of EDC was added and incubated for 30 with occasional sonication The microspheres were then washed with ml of 0.1% sodium dodecylsulfate, followed by washing with ml of 0.02% Tween 20, and finally resuspended in 500 µl TE pH 8.0 [10 mM Tris[hydroxymethyl]aminomethane hydrochloride / mM Ethylenediamine-tetraacetic acid] and stored in the dark at 4°C Coupling efficiency was assessed by hybridizing coupled microspheres with a molar excess of biotinylated oligonucleotide that is complementary to the LUCtag sequence The standard procedure was the same as that detailed below for hybridization of reaction products to the microspheres Effective coupling reactions produced microspheres with a mean fluorescent intensity (MFI) of 2000 to 4000 units Microspheres with MFI less than 1000 were replaced Preparation of Bacterial 16S rDNA Bacterial strains used in this study were obtained from the American Type Culture Collection (ATCC) Prior to extraction, each isolate was streaked on trypticase soy agar and examined for proper colony morphology The identities were verified using the VITEK identification system Bacterial DNA was isolated using the PrepMan™ system (PE Applied Biosystems, Foster City, CA) For 16S rDNA amplification, two separate sets of highly conserved primers were utilized for the amplification from different bacterial species as follows: 27f/1525r, 5′-AGAGTTTGATCMTG- 308 YE ET AL GCTCAG-3′/ 5′-AAGGAGGTGWTCCARCC-3′ and 66f/1392r, 5′-CAGGCCTAACACATGCAAGTC-3′/5′-GGGCGG(t/a)GTGTACAAGGC-3′ [Marchesi et al., 1998] DNA was amplified in 50 µL reaction mixtures containing 10 µl of a 1:250 dilution of template DNA extraction, and PCR buffer containing 100 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1.5 mM MgCl2 The reaction also contained 200 µM dNTPs, two units of AmpliTaq Gold, and 0.4 µM of each primer The PCR reactions included a 10-min incubation at 94°C, followed by 30 cycles of 94°C for 30 sec, 55°C for 45 sec, and 72°C for 90 sec After cycling, the reactions were incubated at 72°C for a final extension of The DNA fragments amplified using the 16S rDNA universal primers were sequenced using standard dideoxynucleotide termination sequencing The generated 16S rDNA sequences and some other reference sequences obtained from GenBank were analyzed with the CLUSTAL W program ASPE Reactions For each SNP (or variable site of 16S rDNA sequence for bacterial identification), a pair of probes was designed such that the last of the 3′end base differed at the polymorphic site (see Table for bacterial ID) For the ASPE assay, 10 µl of pooled, untreated PCR products (10– 20 ng of each amplicon) were added to 10 µl of 2X ASPE reaction mix containing 40 mM TrisHCl (pH 8.4), 100 mM KCl, 2.5 mM MgCl2, 25 nM positive control capture oligonucleotide, 50 nM of each SNP capture oligonucleotide, 1.5 units of Tsp DNA polymerase, and µM biotindCTP An initial denaturing step of at 96°C was used, followed by 30 cycles at 94°C for 30 sec, 55°C for and 74°C for Reactions were held at 4°C prior to the addition of microspheres SBCE Reactions For the SBCE assay, capture probes were designed in such a way that their sequence terminated one base upstream from the SNP site (for bacterial identification, the probes were chosen from conserved regions of the 16S rDNA sequence and ended one base 5′ from a variable Oligonucleotide Sequences of the 3′ End Portion of 16S rDNA Capture Probes for Bacterial Identification TABLE Probe name p1 p2 p3 p4 p5 p6 p7 p8 p9 p10 p11 p12 p13 p14 p15 p16 Probe sequencea CTCCTACGGGAGGCAGCAGT(a/g) ATGTTGGGTTAAGTCCCG(c/t) GGAATCGCTAGTAATCG(c/t) TGTCGTCAGCTCGTGT(c/t) GATGAGTGCTAAGTGTTAG(a/g) TCTCAGTTCGGATTGTAG(g/-) GGTCATTGGAAACTGG(g/a) ACTTTCAGCGGGGAGGAAGG(g/t) AGGGTTGCCAAGCCGCGAGG(g/t) ACTTATAGATGGATCCGCGC(c/t) ATTGGTGCCTTCGGGAACTC(a/-) GAACAAATGTGTAAGTAACT(a/g) TACCGGATAACATTTTGAAC(c/-) GAGTGCTCGAAAGAGAACCG(a/-) GTAACAGGAAGAAGCTTGCT(g/-) GAAACTGGCTTGCTTGAGTCT(t/-) Target siteb 338-357 1041-1058 1296-1312 1019-1034 817-835 1254-1271 630-645 434-453 1211-1230 219-238 979-998 449-468 172-191 981-1000 70-89 638-658 a The variable bases at the 3′ end of the sequence are shown in lower case b The positions of 16S rDNA sequences are based on the E coli sequence as a reference (GenBank accession #JZ83205) nucleotide, see Table 1) Two nearly identical reactions were set up, differing only in the choice of labeled ddNTP (four reactions for bacterial identification) SAP/ExoI-treated PCR products (10–20 ng of each amplicon) were assayed in 20 µl of reaction volumes containing 80 mM of TrisHCl (pH 9.0), mM of MgCl2, 12.5 nM of positive control target oligonucleotide, 12.5 nM of positive control capture oligonucleotide, 25 nM of each SNP capture oligonucleotide, 2.4 units of AmpliTaq FS, µM of the allele-specific labeled ddNTP, and µM each of the other three ddNTPs The reactions were incubated at 96°C for and then cycled 30 times at 94°C, 55°C, and 72°C for 30 sec at each temperature Reactions were held at 4°C prior to the addition of microspheres Hybridization of Enzymatic Reaction Products to the Microspheres To capture each of the labeling reaction products via the hybridization between the ZipCodes at the 5′-ends of the probes and the complementary ZipCodes (cZipCodes) coupled to the microspheres, 1,000 microspheres of each type were added to each reaction The concentrations of NaCl and EDTA were adjusted to 500 mM and 13 mM, respectively The mixtures were FLUORESCENT MICROSPHERE FOR SNP ANALYSIS incubated at 96°C for and 40°C for at least hr The microspheres were washed with washing buffer (150 mM NaCl, 15 mM sodium citrate, 0.02% Tween 20) and pelleted at 1,300 x g for A 96-well pipettor, such as the Robbins Hydra96™, was used for the washing process Biotin labels were developed in µg/ml SA-PE (in washing buffer) at room temperature for 30 in the dark Flow Cytometric Analysis Microsphere fluorescence was measured using a Luminex 100 cytometer (Luminex Corp, Austin, TX) and associated software Each microsphere type in the 100-microsphere set was identified by its characteristic fluorescence of red and infrared wavelengths The orange fluorescence associated with the SBCE or ASPE biological reaction on the surface of the microspheres was collected and converted to the mean fluorescence intensity (MFI) value Since each microsphere type also emitted a small amount of fluorescence in the orange wavelengths of the reporter channel, the inherent, analyte-independent orange fluorescence contributed by each microsphere alone was subtracted from the MFI value of each sample on the corresponding microsphere using a Microsoft Excel spreadsheet MFI values from two corresponding alleles were merged, allowing display of the results on a twocoordinate system in which allelic calls were made using Spotfire software A minimum of 30 microspheres was analyzed per data point RESULTS Microsphere-Based Multiplex SNPs Analysis Using Allele-Specific Primer Extension In order to explore the possibility of setting up the multiplex primer extension in one reaction well (tube), instead of G, A, T, and C reactions separately as in the SBCE assay, we have used the ASPE detection strategy in our microspherebased assay system (Fig 1) The key difference between ASPE and SBCE is the capture probe design For ASPE reactions, the last base of the two allelic probes is coincident with the polymorphic site, while the single SBCE probe ends one base upstream The advantage hereby gained is that for each SNP genotype, only one ASPE re- 309 action is required if the two probes are designed with different ZipCode sequences, while the SBCE assay requires two reactions In our study, the ASPE assay was validated by genotyping 15 SNPs on human chromosome 12 using PCR-amplified target DNA from 96 DNA samples These DNA samples and SNPs had previously been genotyped by gel-based OLA assays A set of 30 unique cZipCode sequences, validated empirically for non-cross-reactivity, was coupled to 30 different microspheres (of 100 possible) for capturing each of the 15 SNPs (one pair of capture probes for each SNP) PCR products were pooled together in one well for each DNA sample After the ASPE reactions were performed with the pooled PCR amplicons, the enzymatic reaction products were captured onto a set of microspheres for flow cytometric analysis as described in Material and Methods Representative ASPE assay results for four SNPs assayed across 96 samples are shown in Figure The ASPE experiment generated signals varying from a low of 400 MFI to a high of 1600 MFI Assay signal intensity was similar to SBCEgenerated signal strength Fourteen of the 15 SNPs were successfully converted to this assay format The concordance rate of 1344 genotypes obtained by ASPE and gel-based OLA was 99.2% Bacterial Identification by Microsphere-Based Multiplex SBCE and ASPE Assays Using 16S rDNA For the SBCE assay, 16 synthetic capture probes were designed The 5′ portion of each probe contained a unique ZipCode sequence and the 3′ portion was identical to the conserved regions of 16S rDNA sequence, ending one base upstream of the 16 variable sites (Table 1) Among them, probes 10–16 are more specific for a certain genus or species For each reaction of the multiplex SBCE assay, a pooled mixture of 16 capture probes was added to the amplified 16S rDNA product The probes were extended and labeled by one base in the presence of the Taq DNA polymerase and biotin-labeled ddNTP, in four separate reactions (ddA, ddG, ddC, and ddT) The probes were then captured by hybridizing to the complementary sequences (cZipCodes) attached to the florescent microspheres 310 YE ET AL FIGURE FLUORESCENT MICROSPHERE FOR SNP ANALYSIS Figure shows the results of the nine variable sites in four bacterial strains The intensity of each of four bases for each 16S rDNA sample is labeled as G, A, T, and C sequentially In most cases, the positive signal to background noise ratio was greater than 10 Since each fluorescent microsphere becomes the address for a single 16S rDNA variable site, combining these 16 probes for a multiplex assay creates a unique pattern for each given bacteria species or genus This pattern divides the gram-positive and gramnegative bacteria into smaller groups, and further into genus and species (Fig 4) For the ASPE assay, a pair of probes for each of the sixteen 16S rDNA variable sites was designed such that their last base differs from each other In the presence of DNA polymerase, dNTPs, and a small amount of biotin-labeled dCTP, a labeled extension product of the 3′ portion of the probe was obtained This occurs if the template included the target sequence For each template sample, only a single two-probe reaction was needed The subsequent hybridizaSchematic presentation of the microspherebased SNP assays DNA fragments containing the polymorphic site to be typed are amplified by PCR For the SBCE assay, PCR products containing a SNP were pooled and treated with SAP and exonuclease I After heat inactivation of the enzymes, the PCR products were used in the SBCE reaction as described in Materials and Methods For each SNP, one capture probe with a unique ZipCode sequence was used to assay the two alleles in each of two separate wells with a different labeled ddNTP per well The probe was extended and labeled by one nucleotide in the presence of Ampli Taq FS DNA polymerase In ASPE reactions, for each SNP, a pair of probes was designed, differing from each other at their extreme 3′ nucleotide (the polymorphic site) In the presence of DNA polymerase, dNTPs and a small portion of the biotin-labeled dCTP, a labeled extension product of the 3′ portion of the primer is obtained, only if the template includes the target sequence For both SBCE and ASPE assays, multiplexed SNP analysis could be achieved by the employment of different ZipCode sequences for different SNPs in the presence of pooled PCR products Microspheres covalently attached with an oligonucleotide encoding the complement to the ZipCode sequence and a luciferase sequence (SeqLUC) are added to the completed reactions and hybridization reactions are carried out at 40°C in the presence of NaCl The microspheres are then subjected to flow cytometric analysis A minimum of 30 microspheres of each type were read and the mean fluorescence intensity (MFI) value was used for determining the genotypes The fluorescence signal contributed by the microsphere alone was subtracted from all data points [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.] FIGURE 311 tion to microspheres and fluorescent dye development procedures were the same as in the SBCE assay The ASPE results agreed with results from the SBCE assay (Fig 3), and were consistent with direct sequencing data in all cases Using these multiplexed assays, 17 bacterial species were divided into 17 groups based on their ASPE or SBCE patterns (see Fig 4) Furthermore, we analyzed three strains of each of five bacterial species: E coli, S aureus, P aeruginosa, B cereus, and L monocytogenes All strains within a species yielded the same pattern, indicating that this microsphere-based SNPs assay system is reliable and accurate DISCUSSION A primary advantage of the fluorescent microsphere technology is the ability to multiplex biological reactions simultaneously in a single reaction vessel [Kettman et al., 1998] Examining multiple variable sites in the same reaction reduces labor, time, and cost compared to DNA sequencing or single reaction-based hybridization methods Another advantage of the microsphere-based readout technology platform is that the enzymatic reactions are conducted in solution, as opposed to methods based on solid-surface reactions This allows us to obtain the benefit of true liquid-phase kinetics We have developed several assays to perform accurate genotyping, and these assays have been adapted to the Luminex 100 fluorimeter for high throughput SNPs analysis This flow cytometric platform offers several major advantages over conventional flow cytometers, including severalfold reduction in initial instrument cost, and an increase in sample throughput by using 96-well plates instead of single tubes We have demonstrated that OLA [Iannone et al., 2000] and SBCE [Chen et al., 2000] assays can be multiplexed using fluorescent microspheres In an attempt to simplify the reaction step in the SBCE assay, in which G, A, T, and C are required to be set up separately for each given DNA template, we have successfully developed an allele-specific primer extension (ASPE) reaction In this method, a pair of allele-specific primers, which differ from each other at the 3′ end (polymorphic site) and encode different ZipCode se- 312 YE ET AL FIGURE Multiplexed SNPs analysis using allele-specific primer extension 1344 genotypes from 96 separate patient samples were analyzed for multiplexed A/G SNPs Representative results for one plate of 96 patient samples across four of 15 SNPs are displayed in cluster plot format Normalized MFI values for the G-allele are plotted on the Y-axis, while Aallele values appear on the X-axis [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.] quences at the 5′ end, is used in the same reaction The DNA polymerase will extend only one primer if the template DNA sequence is homozygous, and both primers will be extended in the case of heterozygotes An advantage over the SBCE reaction is the ability to read alleles from a given SNP in one tube With SBCE, each nucleotide requires analysis in a separate tube when using ddNTP terminators labeled with one fluorochrome This ASPE advantage is possible because the “query” nucleotide is part of the ASPE capture probe while the signal-generating “labeled” nucleotide is the free biotin-dCTP In the SBCE assay, the biotin-ddNTP serves as both “query” and “labeled” nucleotide The necessity of post-PCR cleanup and the addition of unlabeled nucleotides in the ASPE reaction is eliminated The residual dNTPs from the tar- get-generating PCR reaction are further used for the primer extension Although for each SNP assay two types of microspheres are needed for a pair of capture probes, with the set of 100 FIGURE Multiplex ASPE (A) and SBCE (B) assays using nine variable sites of 16S rDNA PCR products were amplified individually from S aureus, P aeruginosa, B cepacia, and E coli using universal primer pair 27f/1525r 10 ng of PCR products were used as template for singletube ASPE, or for A, C, G, or T (shaded columns) SBCE reactions as described in Materials and Methods Capture probes used in this experiment are listed in Table For capturing the reaction products, 1000 microspheres for each SNP were added to the reactions After hybridization at 40°C for more than 60 min, the samples were analyzed by a Luminex 100 flow cytometer The fluorescence intensity on the microspheres is displayed on the Yaxis as the mean fluorescence intensity (MFI) [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.] FLUORESCENT MICROSPHERE FOR SNP ANALYSIS FIGURE 313 314 YE ET AL FIGURE Design of the capture probes for multiplex ASPE or SBCE assays using 16S rDNA A: Physical locations of the 16S rDNA probes Based on the multi-alignment of different bacterial 16S rDNA sequences, 16 conserved regions were chosen for SBCE and ASPE assays For SBCE reactions, probes are designed such that the 3′ end of the primers terminates one base 5′ to the variable site For the ASPE assay, a pair of probes was designed such that the 3′ end differs from each other at the variable site The locations of the probes are listed in Table B: Polymorphic patterns in multiplexed SBCE and ASPE assays Bacterial species can be divided into 17 groups based on their unique readout patterns microspheres available from Luminex Corp (Austin, TX), 50 SNPs per well and up to 96 assays could be analyzed on the much less expensive LX 100 instrument equipped with an XY-plate reader The reading time of the XY-plate reader for one microtiter plate is approximately one hour Over 30,000 genotypes could be generated in an eight-hour day per instrument An even more dramatic increase in throughput could be achieved through multiplexed PCR amplification of the targets and use of automation to allow extended operation We estimate our average cost is less than $0.20 per SNP, excluding the cost of generating the PCR target SBCE and ASPE reactions are comparable in cost To minimize sub- jectivity of genotypic calls, various data-clustering algorithms are currently under development that will allow automatic assignment of genotypes to the different clusters Bacterial identification has become an essential tool in areas such as healthcare and food and water quality testing Traditional methods such as microscopy and culturing techniques are time consuming and have severe limitations Molecular methods have recently been developed for bacterial identification These approaches rely on hybridization to specific DNA fragments or sequence determination of conserved regions from a bacterial genome, usually after amplification of the DNA by PCR The FLUORESCENT MICROSPHERE FOR SNP ANALYSIS DNA sequence for 16S ribosomal RNA is currently the molecule of choice There are several benefits to analyzing 16S rDNA sequences of bacteria as opposed to their biochemical properties First, the 16S rDNA sequence is specific for bacteria at the species level [Kolbert and Persing, 1999] Second, bacterial isolates not need to be subcultured for DNA analysis DNA is present and stable in all living cells Most importantly, DNA can be extracted from the originally isolated colony, amplified, and analyzed in a fraction of the time taken for biochemical analysis So far, the reference method for 16S rDNA analysis involves PCR amplification using conserved primers followed by sequencing or hybridization with species-specific probes [Bottger, 1989; Kirschner and Bottger, 1998; Kolbert and Persing, 1999; Marchesi et al., 1998; McCabe et al., 1999; Tang et al., 2000] These approaches are more sensitive and more specific than most biochemical identifications, but the methods currently available for 16S rDNA analysis are still labor-intensive and often not suitable for routine diagnostics We have successfully adapted our microsphere-based SNP assay system for bacteria identification In our study, by using a combination of capture probes designed from 16 variable sites within the 16S rDNA region for multiplex SBCE and ASPE assays, we were able to discriminate the 17 tested bacterial species based on their unique readout patterns (see Fig 4) Little or no compromise of fluorescent signal was observed between the uniplexed and multiplexed experiments (see Fig 3) A comparison of our assay results with published sequence data showed that the identifications were correct Our results demonstrate that bacterial identification using 16S rDNA can be performed in a simple, multiplexed fashion Multiplex sequence determination is demonstrated by simultaneously probing multiple variable sites from a single polymerase chain reaction (PCR) product Species-specific primer extension reactions and high throughput readout technology employing flow cytometric analysis of microspheres can be rapidly completed Only a single colony or a small amount of bacterial sample is required, and it costs less than one US dollar for each sample analyzed Further work 315 involving the design and validation of more probes from additional 16S rDNA variable sites and other genes will be needed to realize the potential use of this system for high throughput bacterial identification ACKNOWLEDGMENTS The authors thank Philip Rivers, Arash Afshari, and Eric Lai for reagents and helpful discussion, and the Glaxo Wellcome Genotyping Facility and the Glaxo Wellcome Sequencing Core Facility for their services Thanks also are due to Dan Burns of the Genetics Directorate, and Ralph McDade, Van Chandler, Mark Chandler, Jim Jacobson, and Christy Weiss of Luminex Corporation for many helpful discussions REFERENCES Bottger EC 1989 Rapid determination of bacterial RNA sequences by direct sequencing of enzymatically amplified DNA FEMS Microbiol Lett 65:171–176 Cai H, White PS, Torney D, Deshpande A, Wang A, Marrone B, Nolan J 2000 Flow cytometry-based minisequencing: a new platform for high-throughput single-nucleotide polymorphism scoring Genomics 66:135–143 Chen J, Iannone MA, Li MS, Taylor JD, Rivers P, Nelsen AJ, Slentz-Kesler KA, Roses A, Weiner MP 2000 A microsphere-based assay for single nucleotide polymorphism analysis using single base chain extension Genome Res 10:549–557 Chen XN, Levine L, Kwok PY 1999 Fluorescence polarization in homogeneous nucleic acid analysis Genome Res 9:492–498 Cooper DN, Smith BA, Cooke HJ, Niemann S, Schmidtke J 1985 An estimate of unique DNA sequence heterozygosity in the human genome Hum Genet 69:201–205 Fan JB, Chen X, Halushka MK, Berno A, Huang X, Ryder T, Lipshutz RJ, Lockhart DJ, Chakravarti A 2000 Parallel genotyping of human SNPs using generic high-density oligonucleotide tag arrays Genome Res 10:853–860 Fu DJ, Tang K, Braun A, Reuter D, Darnhofer-Demar B, Little DP, O’Donnell MJ, Cantor CR, Koster H 1998 Sequencing exons to of the p53 gene by MALDI-TOF mass spectrometry Nat Biotechnol 16:381–384 Fulton RJ, McDade RL, Smith PL, Kienker LJ, Kettman JR Jr 1997 Advanced multiplexed analysis with the FlowMetrix system Clin Chem 43:1749–1756 Gilles PN, Wu DJ, Foster CB, Dillon PJ, Chanock SJ 1999 Single nucleotide polymorphic discrimination by an electronic dot blot assay on semiconductor microchips Nat Biotechnol 17:365–370 316 YE ET AL Iannone MA, Taylor JD, Chen J, Li MS, Rivers P, Slentz-Kesler KA, Weiner MP 2000 Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry Cytometry 39:131–140 Kettman JR, Davies T, Chandler D, Oliver KG, Fulton RJ 1998 Classification and properties of 64 multiplexed microsphere sets Cytometry 33:234–243 Kirschner P, Bottger EC 1998 Species identification of mycobacteria using DNA sequencing Methods Mol Biol 101:349–361 Kolbert CP, Persing DH 1999 Ribosomal DNA sequencing as a tool for identification of bacterial pathogens Curr Opin Microbiol 2:299–305 Lai E, Riley J, Purvis I, Roses A 1998 A 4-MB high-density single nucleotide polymorphism-based map around human APOE Genomics 54:31–38 Landegren U, Kaiser R, Sanders J, Hood L 1988 A ligasemediated gene detection technique Science 241:1077– 1080 Livak KJ, Marmaro J, Todd JA 1995 Towards full automated genome-wide polymorphism screening Nat Genet 9:341–342 Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Wade WG 1998 Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA Appl Environ Microbiol 64:795–799 McCabe KM, Zhang YH, Huang BL, Wagnar EA, McCabe ERB 1999 Bacterial species identification after DNA amplification with a universal primer pair Mol Genet Met 66:205–211 McDade RL, Fulton RJ 1997 True multiplexed analysis by computer-enhanced flow cytometry Med Dev Diag Indust 19:75–82 McHugh TM 1994 Flow microsphere immunoassay for the quantitative and simultaneous detection of multiple soluble analytes Meth Cell Biol 42:575–595 Mein CA, Barratt BJ, Dunn MG, Siegmund T, Smith AN, Esposito L, Nutland S, Stevens HE, Wilson AJ, Phillips MS, Jarvis N, Law S, de Arruda M, Todd JA 2000 Evaluation of single nucleotide polymorphism typing with Invader on PCR amplicons and its automation Genome Res 10:330–343 Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T 1989 Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms Proc Natl Acad Sci USA 86:2766–2770 Pastinen T, Kurg A, Metspalu A, Peltonen L, Syvanen AC 1997 Minisequencing: a specific tool for DNA analysis and diagnostics on oligonucleotide arrays Genome Res 7:606–614 Pastinen T, Raitio M, Lindroos K, Tainola P, Peltonen L, Syvanen AC 2000 A system for specific, high-throughput genotyping by allele-specific primer extension on microarrays Genome Res 10:1031–1042 Saiki RK, Walsh RS, Levenson CH, Erlich HA 1989 Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes Proc Natl Acad Sci USA 86:6230–6234 Syvanen AC 1999 From gels to chips: “minisequencing” primer extension for analysis of point mutations and single nucleotide polymorphisms Hum Mutat 13:1–10 Tang YW, Von Graevenitz A, Waddington MG, Hopkins MK, Smith DH, Li H, Kolbert CP, Montgomery SO, Persing DH 2000 Identification of coryneform bacterial isolates by ribosomal DNA sequence analysis J Clin Microbiol 38: 1676–1678 Tyagi S, Bratu DP, Kramer FR 1998 Multicolor molecular beacons for allele discrimination Nat Biotechnol 16:49–53  ... length polymorphism (RFLP) analysis, single- strand conformation polymorphism analysis (SSCP) [Orita et al., 1989], allele-specific oligonucleotide hybridization (ASO) [Saiki et al., 1989], oligonucleotide... assay format The concordance rate of 1344 genotypes obtained by ASPE and gel -based OLA was 99.2% Bacterial Identification by Microsphere- Based Multiplex SBCE and ASPE Assays Using 16S rDNA For. .. reduces labor, time, and cost compared to DNA sequencing or single reaction -based hybridization methods Another advantage of the microsphere- based readout technology platform is that the enzymatic