Tgp chi Cong nghe Sinh hoc 11(2): 327-332, 2013 Se DUNG VECTOR pHT01 DE KHAO SAT STY BIEU HIEN TIET PROTEIN CHI THI a-AMYLASE TRONG BACILLUS SUBTILIS WB800N Phan Thi Phtrqng Trang, Nguyen HoM Nam, Trill Linh Think, Nguyen Dtic Huang Triton Dgi hoc Khoa hoc ty nhien, Dai hoc Qujc gia Thanh phi!) 1-1j Chi Minh TOM TAT Su xuat hien plasmid cam Ong thin:mg mai dau tien, pHT01 ben ve mat cau trite da thitc day khuynh huong nghien dm cam ling bleu hien war tnirc protein tai to hgp cho Bacillus subtilis (B subtilis) Cac nghien dm co lien quan den plasmid deu &we thuc hien tren cac Chung B subtilis co nguon goc a 168, nhu B subtilis 1012, nhung chua dugc thuc hiOn Chung B subtilis WB800N — chimg bi dot bien bat hoat protease ngoai bao De than' de, kha rang s6 dung plasmid pHT01 vai B subtilis WB800N bieu hien protein tiet vugt mirc, chimg fed sir dung chi thi a-amylase tiet dugc ma hem bgi amyQ dui Bacillus amyloliquefasciens Plasmid pHT43-amyQ dugc tao va sir dkuig de khao sat bieu hien tiet a-amylase hai chimg B subtilis 1012 va B subtilis WB800N Ket qua cho thay kha nang bieu hien a-amylase tiet hien qua ca hai chimg B subtilis, de lugng protein tao WB800N co phin cao han 1012 Dieu cho thay ti'em rang sir dung plasmid pHT01 vgi B subtilis WB800N cho muc dich bleu hien protein tai to hgp tiet Trr khda: amyQ, Bacillus subtilis, plasmid pHT, pHT01, promoter Pgrac, WB800N M6 DAU Chi& lugc san xuat protein tai t6 hop tir cac cluing vi sinh vat dang dugc phat trien mph va da dat dugc nhtrng tru ding ke nhieu nam qua Co the nil, Escherichia coli (E coli) dugc sir dung nhtr mot nha may san xuat protein tai to hgp tir rat sam va khfi bien cho den (Peti, Page, 2007) Nhung ben canh nhung uu diem nhu th8ng tin di truyen dugc hieu rO, thao tic don gian, co san nhieu loai vector ding nhu cac ching dOt bien co lqi thi E coli lai btic to mot so bat lgi tich buy dOc to, gay benh a ngoai va khong co kha nang tiet protein hieu qua (Petsch, Anspach, 2000) Vi Vay cac chung vi sinh vat an toan hors dang dugc chi tong phit trien, tieu bieu la Bacillus subtilis (B subtilis), mot sinh vat mo hinh cia vi khufin Gram duong Vi khufin co nhieu tru diem nhu: (i) ching vi sinh vat an toan dung thuc pham, dugc to chirc FDA (Food and Drug Administration) eau my dfinh gia la thuc nhOm vi sinh vat an toan; (ii) co kha nang len men a mat d6 cao; (iii) co kha nang tiet hieu qua, protein ngoai to bao, de dang cho viec tinh che protein muc tieu (Harwood, 1992; Schallmey et al., 2004; Schumann, 2007) Hien nay, s6 lugng cac ching B., subtilis dugc irng dung nghien ciru va san xuat cang tang Bang cich tao nhiing dOt bien có lgi, cac nha khoa hoc da tao nhu cau nhieu chimg B subtilis mai phi hop sir dung Tieu bieu so la cac chin mang di5t Nen tren cac protease ngoai bao nhu B subtilis WB800 (Wu et al., 2002) Nhung vi WB800 mang gene khfing chloramphenicol (Cm), khong tuang (Nguyen thich vii ding plasmid pHT, nen WB800N khac phuc nhugc et al., 2011) da dugc tao diem a Promoter du nen dugc sit dung kiem sok su bieu hien tren B subtilis Pspac, cam irng bang Isopropyl (3-D- I -thiogalactopyranoside (IPTG) (Yansura, Henner, 1984)., Tiep sau Q6 la mot boat cac he th8ng sir dung cac chat cam irng nhu tetracycline (GeissendOrfer, Hillen, 1990), xylose (Kim et al., 1996), citrate (Yamamoto et al., 2000), subtilin (Bongers et al., 2005), glycine (Phan, Schumann, 2007) va he thong khfic dua teen T7 RNA polymerase (Chen et al., 2010) Gan day, ching toi tao promoter cam irng mai cho B subtilis throe dat ten la Pgrac (Phan et al., 2006), dung hop tir promoter with groESL co ngtion gee tir B subtilis vii lac operator (lacO) tir E coli, sir dung chat cam img la IPTG, cho kha nang bieu hien protein muc tieu len den 16% protein tong so, gap 50 ban so vii Pspac (Phan et al., 2012) He thong plasmid dau tien dua teen promoter la pHT01 (Nguyen et al., 2007), mot nhung plasmid dugc‘phan plied bai Mobitec Tuy nhien, cac th6ng tin ye nang sir dung cac plasmid co nguOn goc tir promoter Pgrac vii cac ching vi khufin khac van rat han che 327 Phan Thi Ph uvng Trang et al Trong nghien cull nay, nhim mac dich khao sat kha nang sir dung plasmid pHT01 de bleu hien protein tiet chimg chti mai B subtilis WB800N, chimg t6i sir dung gene chi thi amyQ ma Ilea enzyme a-amylase tir B amyloliquefasciens (Palva, 1982) Day la met chi thi dugc sir dung kha phibien cac nghien cuu ve he thong tiet mire de bieu hien de dang nhAn biet thong qua hoat tinh phan cat cau tree amylose tinh bet, lam mat mau thu& di* 12/KI (Nicholson, Chambliss, 1985) Gene amyQ dirge chen vao yang Multi Cloning Site (MCS) cua pHT01 tao pHT43amyQ Sg kiem soat bieu hien tiet a-amylase dm plasmid pHT43-amyQ B subtilis 1012 va B subtilis WB800N Ichito sat VAT LIEU VA PFRIONG PHAP Chiang vi sinh vat, plasmid va moi trierng nuoi cay Chung E coli OmniMAX (Invitrogen) dugc sir dung cac bit& d6ng h6a Hai chung B subtilis dugc sir dung bieu hien protein mix tieu bing chat cam img IPTG: (i) chfing B subtilis 1012 (Saito et al., 1979) bieu hien protease ngoai No; (ii) chimg B subtilis WB800N (Nguyen et al., 2011) mang 'gene khang neomycine thay vi Cm va mang (let bien bit hoat tam protease ngoai bao tir chung WB800 (Wu et a/., 2002) Lru diem cila chimg WB800N la it bieu hien protease ngoai bao, thuAn lgi cho viec bieu hien cac protein dich dang tiet sr tich to tang din va giam sg they phan protein dich ben cac protease ngoai bao Plasmid pHT01 chira promoter Pgrac va gene lad dugc sir dung lam khung man de thiet ke plasmid pHT43-amyQ Mau chting am dugc thgc hien yeti plasmid pHT43 (Nguyen et al., 2011) c6 cAu true F ieng vai pHT01 nhung co them trinh tv tin hieu tiet cua a-amylase, SamyQ Te bit° dirge nuoi cAy tic tren mei tru&ng Luria broth (LB) Or 37°C, khang sinh dugc them vac, vai nOng 40 tuang img (amipicillin 100 lig/mid& vai E coli va Cm 10 lig/m1 doi yeti B subtilis) Te bao dugc trai ten mei tnrang thach chira 2% tinh bet !thong tan de quan sat hoat tinh a-amylase a Thiet ke plasmid Doan gene amyQ (bao gem ca trinh to tiet cua a-amylase) dugc thu nhAn to plasmid pKTH 10 (Palva, 1982) bang phin Ong PCR, sir dung clip mei ON29, 5'GGCCATGGATCCATGATTCAAAAACGAAAG CGGACAG-3' va ON42, 5'GGCCATGACGTCTTTCTGAACATAAATGGAG 328 ACGGAC-3' Doan gene sau khuech dui c6 kich thuOc 1545 by dugc cat vai enzyme cat BamHI va AatII, sau not vai pHT01 ding dugc xir 13% yeti enzyme cat tren Vector tai to hop mai tao thinh dirge dAt ten la pHT43-amyQ San pham not dugc bien nap vao cluing E coli OmniMAX, sang loc va kiem tra doan chen bang giai trinh ttr truck bien nap vao hai chung B subtilis 1012 va B subtilis WB800N Khan sat hotit tinh a-amylase tren dia tkach Sau sang loc va kiem tra, IchuAn lac dun cea hai chung B subtilis 1012 va B subtilis WB800N chira plasmid pHT43-amyQ dugc nuoi cay ten dia LB chira 10 1.1g/m1 Cm kh6ng be sung (0 mM IPTG) hoAc c6 be sung IPTG tir 0,001, 0,01 va 0,1 mM, 2% tinh bet khong tan U 16 gib 37°C Sir dung dung dich 12/KI de xfic dinh yang phan giai tinh bet a-amylase (Nicholson, Chambliss, 1985) Chirng am la pHT43 cam Ong v6i 0,1 mM IPTG Thi nghiem dugc leP lai lan ten Ichuin lac khic Cam Ong bieu hien a-amylase tren moi tritinig long Hai chung B subtilis 1012 va B subtilis WB800N dugc nuoi cAy mei truang LB yeti khang sinh Cm 10 gg/ml Or 37°C va Vic de tic 250 vang/phet Den to bac) vao gift pha log, ODA dat 0,8 tien hanh cam Ong neng de IPTG (0, 0,001, 0,01 va 0,1 mM) Mau dugc thu 0, 2, va h sau cam Ong Thgc hien twang to yeti mau chimg am la hai chimg B subtilis 1012 va B subtilis WB800N chira plasmid pHT43, cam img va thu mau am 6 h Thi nghi'em dugc lAp lai lAn ten khuAn lac khfic Klein tra sg bieu hien bing SDS-PAGE Mau sau thu a cac thai diem se dugc tach to bao khoi mei truemg nuoi cAy bang ly tam (13000 yang/phut Or 4°C 10 phut) Protein c6 dich nuoi cay dugc thu nhAn bang phuang phap tea TCA (40%), yen ti le TCA va dich nuoi cay la 1:3, it di 10 phut Sau de ly tam (13000 vang/phiit It 4°C 10 phut) thu tea va rim tea Ian vOn aceton lanh Phai Icho a nhiet de phang, be sung ntrac, sample buffer va bien tinh bing nhiet (95°C, phut) Tien hanh dien di SDS-PAGE tren gel polyacrylamide 12% va tinh ti le a-amylase tren tang s6 protein tiet bing phan mem AlphaEaseFC (Alpha Innotech) (http://genetictechnologiesinc.com/alpha/alpha_ease fc.htm) Top chi Gong nghe Sinh hoc 11(2): 327-332, 2013 KET QUA VA THAO LUAN That Ice vector pHT43-amyQ Gene amyQ duqc thu nhan bang phan 1mg PCR vai cap mai dac hieu mang trinh tu nhan biet cita enzyme cat giai han BamHI va AatII San pham PCR (1545 bp) va plasmid pHT01 dugc xtr ljr vai hai enzyme BamHI va AatII, sau tien hanh pban ung not vai enzyme T4 ligase Sin pham not dtrat bien nap vao E coli OmniMAX, sau tien hanh sang loc va giai trinh to nham xac dinh plasmid pHT43amyQ Plasmid tai to hqp sau tach chiet tin chung E coli OmniMAX/pHT43-amyQ se duqc bien nap vao B subtilis 1012 va B subtills WB800N.,Trai tren mai truong LB-Cm nham sang lac nhang to bio mang plasmid attic tieu Cfic lchuan lac dac B subtilis 1012/ pHT43-amyQ va B subtilis WB800N/ pHT43-amyQ se duqc sir dung cho cfic thi nghiem khao sat a phan sau Khao sit ho#t tinh a-amylase Ithuan lac clan B subtilis 1012 va B subtilis WB800N mang plasmid pHT43 hoac pHT43-amyQ duqc cham sang dia LB b6 sung Cm, 2% tinh bOt khong tan, khong china chat cam an (Hinh 1B) hoac pHT43 IPTG 0,1 mM co chira chat cam img vai Ming dO IPTG la 0,001, 0,01 va 0,1 mM, it 16 gia a 37°C VOng phan giai tinh bOt hinh a-amylase duqc tiet moi truang xung quanh phan cat cau trac amylose tong tinh bOt, yang moil truerng thieu tinh bOt khong the cing bat mau vai dung dich 12/KI, yang phan r6ng a-amylase duqc tiet tang nhieu Ket qui cho thay hai chung B subtilis mang plasmid pHT43amyQ cho thrtmg kinh vOng phan giai tinh bqt 1(m han nhieu (Binh 1B; mM IPTG va Hinh 1C; 0,1 mM IPTG) so vai chimg am, B subtilis mang plasmid pHT43 (Hinh IA) Dieu chung to gene amyQ tren pHT43-amyQ duqc bieu hien vtrqt mint dual su dieu him dm promoter manh Pgrac cac n6ng d6 IPTG 0,001 mM va 0,01 mM cho yang phan giai lan han tnr&ng hqp mM IPTG va nh6 han tnamg hqp 0,1 mM IPTG, nhtmg khong clang ke (ket qui kh6ng the hien) So sanh giaa hai chung B subtilis, yang phan giai tinh bOt xung quanh khufin lac B subtilis WB800N (Hinh 1, Dtrai) hai cao han so vai yang phan giai dm B subtilis 1012 (Hinh 1, Tren) Nhu vay, viec loai 136 protease ngoai bio B subtilis WB800N cho phep a-amylase tiet m6i trutmg co phan hai cao han so vai chung B subtilis 1012 pHT43-amyQ mM 0,1 mM 1012 WB800N A Hinh Khdo sat sty Neu hiOn oda a-amylase ten dia thach B subtilis 1012 tie B subtills WB800N cht"ra plasmid pHT43- kh8ng cam Ong (B) hoac co cam Ong vai IPTG b nOng dO 0,1 mM (C) MAu chirng am pHT43 duvc cam Ong vol 0,1 mM IPTG (A) Duteng ke mau trangli ban kinh yang phan amyQ Cam Ong bleu Ihre'n va SDS-PAGE De danh gib mint d'6 bieu hien va tiet a-amylase truck va sau cam ang, chung toi tien hanh nuoi cay cua hai cluing B subtilis 1012 va B subtilis WB800N china riasmid pHT43 hoac pHT43-amyQ moi truong LB-Cm; cam ang vai 0,001, 0,01 va 0,1 mM IPTG va thu mitt sau 0, 2, 4, gily cam 329 Phan Thi Phut:mg Trang et al Ong Dich nuoi city china a-amylase ducc thu nhan va xir ly nhu da pen a phanVat lieu — Phucmgphap Quan sat ket qua a mau cam ling vai Wing IPTG thap (0,001 va 0,01 mM) (Hinh 2), muc de bieu hien protein muc tieu rat thap, ttrcmg ducmg vai mau 'thong cam Cmg (Hinh 2; h) Tuy nhi'e'n, tang nOng de IPTG len 0,1 mM thi mac de bleu hien A kDa lai tang clang Ice len den 30% protein tang se (AlphaEaseFC) Trong cac matt twat cam ling (Hinh 2; h) Ichong nhan thay str hien diett cda voch protein muc tieu Nhu vay su chenh loch ve muc de bieu hien giva tnrac va sau cam ling rat cao, hay not cfich khfic, kha nang kiem sok bieu hien cita promoter Pgrac la rat chat che B subtilis 1012 / pHT43-amyQ 2h M pHT43 h 4h 0001 0AI 01 0.001 200 0.01 01 6h 0.001 aol 100 411.0"-ArnY° m0 iris &MO Wilm 30- Iwo aa B subtilis WB800N / pHT43-amyQ 2h tiki 'amok imaa 0001 001 4h 01 0001 001 I 6h 0001 001 01 am MAN ,inow - Hinh Kdt qud diOn di SDS-PAGE M, thang protein PageRuler rm Unstained (Fermentas) Chung B subtilis 1012 (A) va B subtilis WB800N (B) mang plasmid pHT43-amyQ cam Ong bang IPTG vai n6ng d0 mM (0), 0,001 mM (0,001), 0,01 mM (0,01), 0,1 mM (0,1) ODA dot 0,8 Thu mau b cac thal dittrn gib (0 h), gib (2 h), gig' (4 h), gib, (6 h) deoi vai pHT43-amyQ; mau cht:rng am thu b gib, (pHT43) So sinh sv bieu hien protein ngoai bao a hai cluing B subtilis, to thay, chi:mg B subtilis WB800N (Hinh 2B) cho vach protein muc tieu dam han so vai chung B subtilis 1012 (Hinh 2A), re nhat a mau gia sau cam ling Chimg to, ltrung a-amylase tao dr B subtilis WB800N nhieu han so WA B subtilis 1012 Ket qua hoin loan Oft hup vai hoot tinh a-amylase bieu hien ten dla thong qua yang phan giai ten dia tinh bet (Hinh 1) Tuy nhien, so sinh 330 tS, le a-amylase ten tong se' protein tiet thi B subtilis 1012 lai cho ket qui tot han vai 30% (AlphaEaseFC); khi, a B subtilis WB800N thi tjr le chi dot khoang 25% (AlphaEaseFC) mac du Itrung protein muc tieu bieu hien nhieu han B subtilis 1012 Nhu vay viec loai be tam protease ngoai bao a B subtilis WB800N giftp halt che phan cat protein muc tieu, nhtmg cling lam tich to nhieu protein tiet khac mei tnrang Tgp chi Cong nghe Sinh hpc 11(2): 327-332, 2013 THAO LUAN Nhting nghien ciru dau tien ve viec bieu hien protein a-amylase B subtilis &roc thuc hien b6i Palva vao nam 1982 Gene amyQ tir B amyloliquefasciens &roc phan lap va chen vao plasmid pUB110 (Keggins et al., 1978), ket qua hinh plasmid pKTH10 cho kha nang bieu hien aamylase tang gap 2500 Ian so yeti chimg B subtilis Marburg va gap Ian so v6i B amyloliquefasciens (Palva, 1982) Day la met plasmid sao.chep cuen ton c6 tiem nang !thong on dinh ve eau trac (Schumann, 2007), vai so luting ban 50 plasmid/te bao va to cam irng Met so nghien ciru gan day chimg toi cho thay, viec Ai) dung promoter Pgrac, vac) cac plasmid bieu hien tiet aamylase cho ket qua Luang ducmg v ri pKTH 10 (Phan et al., 2006) Tuy nhien, so vii pKTHIO c6 g6c tir pUB 110 thi pHT01 co ratting tru diem vuort trei: (i) co the chep theta, giup on dinh ye mat cau trite to bao, (ii) so luting ban — plasmid/te bao, hart the bleu hien nen va (iii) dac diem cam img bang IPTG cho phep kiem sok tot viec bieu hien protein muc tieu \Teri uu diem nay, Pgrac da cho thay tiem nang irng dung hieu qua viec dieu hoa bieu hien protein tai to hop, nhat la nhimg protein gay dee cho to bao va gidp bieu hien protein muc tieu i nhang thOi diem mc;ng muon Viec sir dung chimg (let Wen B subtilis WB800N cho phep protein muc tieu bieu hien nhieu m8i tnrang nuoi cay it bi anh hu6ng boi protease ngoai bao, cho thay hieu qua sir dung chimg dot bien Tuy nhien, viec giam tiet cac protein khac (ngoai protein muc tieu) moi twang coy nglira rat quan tong ,khi tinh sach sau bieu hien Do d6, met hart che ctia B subtilis WB800N la cho phep tich to nhieu protein ngoai bao khac, dieu lam giam phan tram protein muc tieu teen tong so protein tiet Mac di' vay, vii kha Jiang bleu hien wet tot len den 25% tong protein ngoai bao thi B subtilis WB800N se la met cluing chit tiem nang viec bieu hien protein muc tieu du6i clang tiet, dac biet la nhang protein de bi phan cat 136i protease ngoai bao Trong do, cac chung bieu hien protease ngoai bao nhu B subtilis 1012 lai thich hop cho viec bieu hien cac protein tai to hgp tuung doi ben v6i cac protease KET LUAN Tir ket qua kith) sat hoat tinh a-amylase tren dia thach va su bieu hien trong,moi trutmg long the hien tren SDS-PAGE, CO the ket luan nhu sau Plasmid pHT01 chira promoter Pgrac met he vector bieu hien manh cho B subtilis giup dieu hoa bieu hien gene muc tieu met cach hieu qui len den han 25% tong protein flit Plasmid pHT01 c6 the sir dung cling v6i chung B subtilis WB800N viec bieu hien tiet protein mix tieu, (lac biet phi' hop cho nhitng protein bi thity phan bori protease ngoai bat) dm B subtilis a Ltd cam ant Nghin e cau dupy tai trpr phat trien khoa hpc va corm nghe quoc gia (NAFOSTED) de tai and so 106.16-2011.80 TAI LIEU THAM KHAO Bongers R, Veening J, Van Wieringen M, Kuipers O,Kleerebezem M (2005) Development and Characterization of a Subtilin-Regulated Expression System in Bacillus subtilis: Strict Control of Gene Expression by Addition of Subtilin Appl Environ Microbiol 71: 8818-8824 Chen P, Shaw J, Chao Y, David Ho T, Yu S (2010) Construction of Chromosomally Located T7 Expression System for Production of Heterologous Secreted Proteins in Bacillus subtilis J Agric Food Chem 58: 5392-5399 Geissendorfer M, Hillen W (1990) Regulated expression of heterologous genes in Bacillus subtilis using the Tn10 encodedtet regulatory elements Appl Microbiol Biotechnol 33: 657-663 Harwood CR (1992) Bacillus subtilis and its relatives: molecular biological and industrial workhorses Trends Biotechnol 10: 247-256 Keggins KM, Lovett PS, Duvall EJ (1978) Molecular cloning of genetically active fragments of Bacillus DNA in Bacillus subtilis and properties of the vector plasmid pUB110 Proc Natl Acad Sci USA 75: 1423-1427 Kim L, Mogk A, Schumann W (1996) A xylose-inducible Bacillus subtilis integration vector and its application Gene 181: 71-76 Nguyen HD, Phan TT, Schumann W (2011) Analysis and application of Bacillus subtilis sortases to anchor recombinant proteins on the cell wall Amb Express 1: 22 Nguyen HD, Phan TTP, Schumann W (2007) Expression vectors for the rapid purification of recombinant proteins in Bacillus subtilis Curr Microbiol 55: 89-93 Nicholson WL, Chambliss GH (1985) Isolation and characterization of a cis-acting mutation conferring catabolite repression resistance to alpha-amylase synthesis in Bacillus subtilis J Bacteriol 161: 875-881 331 Phan Thi Phirqng Trang et al Palva I (1982) Molecular cloning of alpha-amylase gene from Bacillus amyloliquefaciens and its expression in B subtilis Gene 19: 81-87 Peti W, Page R (2007) Strategies to maximize heterologous protein expression in Escherichia coli with minimal cost Protein Expr Purif 51: 1-10 Petsch D, Anspach FB (2000) Endotoxin removal from protein solutions J Biotechnol 76: 97-119 Phan TIP, Nguyen HD, Schumann W (2006) Novel plasmid-based expression vectors for intra- and extracellular production of recombinant proteins in Bacillus subtilis Protein Expr Purif 46: 189-195 Phan TR, Nguyen HD, Schumann W (2012) Development of a strong intracellular expression system for Bacillus subtilis by optimizing promoter elements J Biotechnol 157: 167-172 Phan TTP, Schumann W (2007) Development of a glycine-inducible expression system for Bacillus subtilis J Biotechnol 128: 486-499 Saito H, Shibata T, Ando T (1979) Mapping of genes determining nonpermissiveness and host-specific restriction to bacteriophages in Bacillus subtilis Marburg Mol Gen Genet Mgg 170: 117-122 Schallmey M, Singh A, Ward OP (2004) Developments in the use of Bacillus species for industrial production Can J Microbiol 50: 1-17 Schumann W (2007) Production of recombinant proteins in Bacillus subtilis Adv Appl Microbiol 62: 137-189 Wu SC, Yeung JC, Duan Y, Ye R, Szarka SJ, Habibi HR, Wong SL (2002) Functional production and characterization of a fibrin-specific single-chain antibody fragment from Bacillus subtilis: effects of molecular chaperones and a wall-bound protease on antibody fragment production Appl Environ Microbiol 68: 32613269 Yamamoto H, Murata M, Sekiguchi J (2000) The CitST two-component system regulates the expression of the Mgcitrate transporter in Bacillus subtilis Mol Microbiol 37: 898-912 Yansura DG, Hamer DJ (1984) Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis Proc Nati Acad Sci USA 81: 439-443 STUDY ON SECRETIONAL EXPRESSION OF a-AMYLASE REPORTER IN BACILLUS SUBTILIS WB800N USING VECTOR pHT01 Phan Thi Phuong Trang, Nguyen Hoai Nam, Tran Linh Thuoc, Nguyen Due Hoangs University of Science, Vietnam National University Ho Chi Minh City SUMMARY The appearance of the first comericial plasmid pHT01 promotes the study for inducible over-expression of recombinant protein in Bacillus subtilis (B subtilis) Most of researches published relating to this plasmid used B subtilis 168 derivatives, such as 1012 strain, but not with WB800N — eight-fold protease-deficient strain To explore the possibility to use plasmid pHT01 with B subtilis WB800N for secretional over-expression of recombinant protein, we used secretional reporter protein, a-amylase encoded by amyQ from Bacillus amyloliquefasciens Plasmid pHT43-amyQ was constructed from pHT01 and used to investigate the secretional expression of a-amylase in both B subtilis 1012 and B subtilis WB800N The results showed that a-amylase could be produced efficiently in both strains, in which the amount of the reporter from WB800N was higher than that from 1012 This result suggests that plasmid pHT01 can be used with B subtilis WB800N for secretional expression of recombinant protein Keywords: amyQ, Bacillus subtilis, plasmid pHT, pHT01, promoter Pgrac, WB800N * Author for correspondce: E-mail: ndhoang@hcmus.edu.vn 332 ... suggests that plasmid pHT01 can be used with B subtilis WB800N for secretional expression of recombinant protein Keywords: amyQ, Bacillus subtilis, plasmid pHT, pHT01, promoter Pgrac, WB800N * Author... vao hai chung B subtilis 1012 va B subtilis WB800N Khan sat hotit tinh a -amylase tren dia tkach Sau sang loc va kiem tra, IchuAn lac dun cea hai chung B subtilis 1012 va B subtilis WB800N chira... (pHT43) So sinh sv bieu hien protein ngoai bao a hai cluing B subtilis, to thay, chi:mg B subtilis WB800N (Hinh 2B) cho vach protein muc tieu dam han so vai chung B subtilis 1012 (Hinh 2A), re