Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

Transient potential receptor channel controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma Dorina Veliceasa1, Marina Ivanovic2, Frank Thilo-Schulze Hoepfner1, Praveen Thumbikat1, Olga V Volpert1 and Norm D Smith1 Department of Urology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL, USA Keywords angiogenesis; calcium metabolism; renal cancer; thrombospondin Correspondence O V Volpert, Department of Urology, Northwestern University, 303 East Chicago Ave., Chicago, IL 60611, USA Fax: +1 (312) 908 7275 Tel: +1 (312) 503 5934 E-mail: olgavolp@northwestern.edu (Received June 2007, revised 14 September 2007, accepted 18 October 2007) doi:10.1111/j.1742-4658.2007.06159.x Angiogenic switch in renal cell carcinoma (RCC) is attributed to the inactivation of the von Hippel–Lindau tumor suppressor, stabilization of hypoxia inducible factor-1 transcription factor and increased vascular endothelial growth factor To evaluate the role of an angiogenesis inhibitor, thrombopsondin-1 (TSP1), we compared TSP1 production in human RCC and normal tissue and secretion by the normal renal epithelium (human normal kidney, HNK) and RCC cells Normal and RCC tissues stained positive for TSP1, and the levels of TSP1 mRNA and total protein were similar in RCC and HNK cells However, HNK cells secreted high TSP1, which rendered them nonangiogenic, whereas RCC cells secreted little TSP1 and were angiogenic Western blot and immunostaining revealed TSP1 in the cytoplasm of RCC cells on serum withdrawal, whereas, in HNK cells, it was rapidly exported Seeking mechanisms of defective TSP1 secretion, we discovered impaired calcium uptake by RCC in response to vascular endothelial growth factor In HNK cells, 1,2-bis(o-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester, a calcium chelator, simulated TSP1 retention, mimicking the RCC phenotype Further analysis revealed a profound decrease in transient receptor potential canonical ion channel (TRPC4) Ca2+ channel expression in RCC cells TRPC4 silencing in HNK cells caused TSP1 retention and impaired secretion Double labeling of the secretory system components revealed TSP1 colocalization with coatomer protein II (COPII) anterograde vesicles in HNK cells In contrast, in RCC cells, TSP1 colocalized with COPI vesicles, pointing to the retrograde transport to the endoplasmic reticulum caused by misfolding Our study indicates that TRPC4 loss in RCC leads to impaired Ca2+ intake, misfolding, retrograde transport and diminished secretion of antiangiogenic TSP1, thus enabling angiogenic switch during RCC progression Abbreviations BAPTA-AM, 1,2-bis(o-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester; bFGF, basic fibroblast growth factor; CEP, circulating endothelial precursor; CM, conditioned media; COP, coatomer protein; CXCR2, CXC chemokine receptor 2; EGF, epidermal growth factor; ER, endoplasmic reticulum; ERGIC, ER–Golgi intermediate compartment; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HIF, hypoxia inducible factor; HMVEC, human microvascular endothelial cell; HNK, human normal kidney, normal renal epithelial strain; HRP, horseradish peroxidase; HSP, heat shock protein; IL, interleukin; PDGFR, platelet-derived growth factor receptor; PEDF, pigment epithelial-derived factor; PTEN, phosphatase and tensin analog; RCC, renal cell carcinoma; TIMP, tissue inhibitor of metalloproteinase; TRPC4, transient receptor potential canonical ion channel 4; TSP1, thrombospondin-1; VEGF, vascular endothelial growth factor; VHL, von Hippel–Lindau FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6365 Thrombospondin-1 loss in renal cancer D Veliceasa et al The prevailing treatments for kidney cancer are surgery and immunotherapy Until 2005, only high-dose interleukin-2 (IL-2) had been approved by the US Food and Drug Administration (FDA) [1] As immunotherapy has unfavorable side-effects, new targeted therapies to counter the molecular triggers of renal cell carcinoma (RCC) are in high demand Clear cell RCC is largely caused by inactivation of the von Hippel–Lindau (VHL) tumor suppressor [2] The main target of the VHL tumor suppressor is hypoxia inducible factor-1a (HIF1a), an oxygen-sensing transcription factor, which undergoes regulatory hydroxylation at normal Po2[3] The VHL tumor suppressor binds hydroxylated HIF1a, targets it for proteasome degradation and thus suppresses HIF proangiogenic targets, vascular endothelial growth factor (VEGF) and erythropoietin, and pro-survival targets, enabling stress-induced apoptosis [4] Novel RCC therapies target VEGF (Avastin) [5] or its receptor (sunitinib, sorafenib) [6] The latter also target VEGFproducing tumor stroma by inactivating another tyrosine kinase, platelet-derived growth factor receptor-b (PDGFRb) [1] However, VEGF induction by HIF1a alone is insufficient to promote the growth of RCC xenografts [7] The exclusive role of VEGF in RCC progression ⁄ angiogenesis has been challenged by the studies of other angiogenic stimuli, including ELR+ CXC chemokines, such as IL-8, and CXC chemokine receptor (CXCR2) ligands [8,9] or IL-2 via CXCR3 [10] or basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF) [11–14] In contrast, antiangiogenic proteins in RCC progression and angiogenesis have been largely ignored A few studies have implicated pigment epithelial-derived factor (PEDF) in Wilms’ tumor [15]; however, there are no data that link PEDF and RCC Other studies have demonstrated that the more aggressive Wilms’ tumors are characterized by low levels of antiangiogenic thrombospondin-1 (TSP1) [16] TSP1 is also secreted by glomerular mesangial cells [17] In another study, small, mildly angiogenic tumors were found to produce more TSP1 than more aggressive counterparts [18] We therefore hypothesize that TSP1 supports normal kidney angiostasis, and that its loss contributes to the RCC angiogenic phenotype TSP1 is a multifunctional extracellular matrix protein, and a potent and versatile angiogenesis inhibitor that is critical for the maintenance of the antiangiogenic microenvironment in multiple organ sites, including breast, brain, colon and skin [19] Conversely, re-introduction of TSP1 or its active peptides blocks angiogenesis in a variety of experimental tumors and metastases 6366 [20] The tumor suppressor genes p53, phosphatase and tensin analog (PTEN) and SMAD4 maintain normal, high levels of TSP1 expression (reviewed in [21]) Conversely, the oncogenes Id-1, Jun, Myc, Ras and Src repress TSP1 production and thus flip the angiogenic switch on and enable tumor growth [21] TSP1 inhibits multiple endothelial cell functions, such as migration, proliferation and lumen formation [20] In addition, TSP1 causes endothelial cell apoptosis and thus compromises the integrity of the tumor vasculature [22] Finally, TSP1 regulates the numbers of circulating endothelial precursor (CEP) cells, and thereby impinges on VEGF-mediated CEP cell recruitment to the sites of neovascularization [23] A knowledge of the molecular mechanisms that cause TSP1 loss in the tumor microenvironment is instrumental to determine a subset of tumors that would benefit from TSP1based therapies and to aid in the development of novel targeted therapies to control them In this article, we show that disrupted TSP1 secretion renders RCC cells pro-angiogenic Seeking underlying mechanisms, we found that RCC cells fail to mount calcium uptake in response to growth factors, probably as a result of the low expression levels of the two calcium exchange proteins, calbindin and transient receptor potential canonical ion channel (TRPC4) Calcium deficiency is critical for the correct folding and secretion of TSP1: the calcium chelator 1,2-bis(oaminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid acetoxymethyl ester (BAPTA-AM) caused retrograde transport and retention of TSP1 by otherwise normal renal epithelium (human normal kidney, normal renal epithelial strain, HNK) TSP1 misfolding caused by calcium deficiency led to its retrograde transport, intracellular retention and diminished secretion Thus, the loss of TSP secretion as a result of epigenetic changes may deplete antiangiogenic TSP1 in the tumor environment and cause conditions permissive for angiogenesis Results TSP1 suppresses angiogenesis in normal kidney epithelium Seeking a role for TSP1 in the evolution of the angiogenic response in RCC, we stained 11 human RCC specimens and six specimens of adjacent normal tissue for TSP1 Based on the assumption that TSP1 maintains angiostasis in the kidney, we expected TSP1 to be lower in RCC tissues Surprisingly, RCC and adjacent normal tissue showed similar staining intensities (Fig 1A; Table 1) FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al Thrombospondin-1 loss in renal cancer A B Fig Role of TSP1 in angiogenesis, and localization in renal cells and tissue (A) Sections of RCC tumors and adjacent normal tissue (HNK) were stained for TSP1 and counterstained with hematoxylin (B, C) CM from HNK and P769 RCC cells were tested in the mouse corneal assay TSP1 in HNK cells was silenced using siRNA; the silencing was verified by RT-PCR and western blot of CM (B) VEGF was neutralized with antibodies (C) Representative corneas are shown There was a lack of angiogenic response to HNK CM and a robust response to RCC CM In addition, TSP1 neutralization restored the angiogenic activity of HNK CM; VEGF neutralizing antibodies reversed this effect and abolished the angiogenic activity of RCC CM (D) RNA isolated from the indicated cell lines was subjected to semiquantitative RT-PCR with TSP1 primers HNK, normal cell strain; P769, PRC9, SW839, ARZ-1 and WT8, RCC cell lines (E) The same cell lines were subjected to 24 h serum deprivation, CM and cell lysates (CM and L, respectively) were collected and TSP1 was detected by western blotting Note the low TSP1 secretion and higher intracellular levels in RCC cells (F) HNK and P769 cells were cultured for 24 h in full serum or serum-free medium, fixed and stained for TSP1 Note the depletion of TSP1 in the cytoplasm of normal cells C D E F FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6367 Thrombospondin-1 loss in renal cancer D Veliceasa et al Table TSP1 and VEGF immunostaining of kidney cancer and normal tissue Human tumor samples were stained for TSP1 and VEGF, respectively The slides were scored by two independent pathologists (double-blind study) TSP1 Tissue or tumor type Normal tissue RCC, grade 1–2 RCC grade 3–4 VEGF Case (n) Staining intensity 4 +++ ++ +++ ++ +++ ++ Case (n) Staining intensity 2 + +++ +++ ++ + +++ ++ In contrast, HNK and RCC cell lines differed in their ability to induce angiogenesis Conditioned media (CM) from P769 and other RCC cell lines were potently angiogenic in rat and mouse corneal assay for angiogenesis CM from normal HNK cells was nonangiogenic; however, it became angiogenic if TSP1 was either neutralized with antibodies or silenced using siRNA (Fig 1B,C; Table 2) 786-O-WT8 cells were weakly angiogenic in vivo and in vitro as a result of the low levels of secreted VEGF; angiogenesis was only marginally altered by TSP1 depletion (Table 2) Both HNK and RCC cells produced VEGF (measured by ELISA); RCC cells produced three- to fourfold more VEGF than HNK or 698-O-WT8 cells (Table 3) In contrast, quantitative western blots showed that HNK CM were high in TSP1 [ 2.6 lgỈ(100 lg total protein))1], whereas RCC cells secreted less than 0.12 lgỈ(100 lg protein))1, regardless of VHL status (Table 3; Fig 1E) Using human microvascular endothelial cell (HMVEC) chemotaxis as an in vitro measure of angiogenesis, we determined the specific activity (ED50) of each CM alone and with VEGF or TSP1 neutralized (Table 3) CM from 786O-ARZ, PRC9, SW839 and p769 showed high specific activity, reflective of the VEGF levels In contrast, the HNK CM was nonangiogenic: TSP1 depletion with neutralizing antibodies revealed underlying angiogenic activity in HNK cells, which, in turn, was blocked by VEGF antibodies (Table 3) RCC, but not normal kidney epithelium, retains TSP1 Despite the difference in secreted TSP1, TSP1 mRNA levels were similar in HNK and RCC cells (Fig 1D) RCC and HNK cells also produced roughly equal total TSP1 protein [43 ± 5.3 and 42 ± 7.1 ngỈ(10 lg protein))1, respectively, P ¼ 0.48], as calculated using data from Fig 1E However, RCC cells secreted noticeably less TSP1 than did HNK cells (Fig 1E) In contrast, lysates of serum-starved HNK cells contained no detectable TSP1, whereas TSP1 was found at high levels in the cytoplasm of all RCC lines (Fig 1E) Immunocytochemistry of fixed cells showed robust cytoplasmic staining for TSP1 in both HNK and RCC cells cultured Table Corneal angiogenesis by conditioned media (CM) Media conditioned by the indicated cell lines were tested in rata or mouseb corneal neovascularization assay (see Experimental procedures) The results are expressed as positive corneas of the total implanted To evaluate the statistical significance of the changes in angiogenic activity as a result of inactivation of TSP1 and ⁄ or VEGF, the results were expressed as the percentage of positive responses, grouped and subjected to Student’s t-test TSP1 inactivation in the HNK CM (antibody or siRNA silencing) significantly increased its angiogenic activity (P ¼ 0.023); further addition of VEGF inactivating antibodies returned the angiogenic activity to levels that were not significantly different from those of the initial HNK CM (P ¼ 0.085); angiogenesis by CM from all the tumor cell lines was significantly different from that of the HNK cells and WT8 revertant (P ¼ 0.0026) VEGF neutralizing antibody decreased angiogenesis by P769 to a value that was not significantly different from that of unaltered HNK CM (P ¼ 0.13) and was significantly lower than the activity of unaltered tumor CMs (P ¼ 0.0002) Positive responses per total implants for CM Antibody HNK a PRC9 P769 ⁄ (0%) TSP1 Ab VEGF Ab a 786-O-ARZ a 786-O-WT8 ⁄ (87.5%) ⁄ (100%) ⁄ 6b (83.3%) ⁄ (75%) ⁄ (87.5%) ⁄ 7a (28.5%) ⁄ 8a (37.5%) ⁄ 8b (12.5%) ⁄ 8a (25%) ⁄ 8a (12.5%) ⁄ 5a (0%) ⁄ 8a (62.5%) TSP1 Ab + VEGF Ab Scrambled siRNA TSP1 siRNA TSP1 siRNA + VEGF Ab a SW839 ⁄ 8a (12.5%) None a ⁄ 9b (2.2%) ⁄ 9b (11%) ⁄ 10b (80%) ⁄ 10b (40%) a Tested in rat bTested in mouse 6368 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al Thrombospondin-1 loss in renal cancer Table Angiogenic characteristics of the conditioned media (CM) CM from the indicated cell lines were collected and subjected to the following analyses: (a) VEGF levels were measured by ELISA; (b) TSP1 levels were measured by densitometry analysis of western blots; (c) ED50 was measured in the endothelial cell chemotaxis assay; ED50 of RCC CM was also measured in the presence of VEGF neutralizing antibody (1 lgỈmL)1) and TSP1 neutralizing antibody (2.5 lgỈmL)1) where shown; (d) corneal angiogenesis was tested in rat assay (see Experimental procedures) and scored Pellets contained 1.25 or 2.5 lg of total protein The antibodies were added at and lg per pellet where indicated N ⁄ A, not assessed CM Secreted VEGF (pgỈmg)1) Secreted TSP (lgỈmg)1) HNK PRC9 SW839 P769 786-O-ARZ 786-O-WT8 320 1140 830 1060 1310 130 2.6 0.15 0.07 0.19 0.11 0.06 ± ± ± ± ± ± 80 310 220 270 330 30 ± ± ± ± ± ± 0.46 0.08 0.05 0.1 0.4 0.03 ED50 (lgỈmL)1) Corneal angiogenesis TSP1 Ab No Ab VEGF Ab TSP1 Ab No Ab VEGF Ab > 20 0.10 0.17 0.12 0.05 0.52 N⁄A 7.9 9.2 6.8 12.0 > 20 0.33 N⁄A N⁄A N⁄A N⁄A N⁄A – ++ ++ ++ ++ +⁄– N⁄A – +⁄– +⁄– – – + N⁄A N⁄A N⁄A N⁄A +⁄– in full serum After 12–24 h without serum, TSP1 was depleted from the HNK cytoplasm as a result of secretion, but retained by P769 RCC (Fig 1F) VHL tumor suppressor had no effect on secreted TSP1: TSP1 secretion was comparable in 786-O-WT8, 786-O-ARZ and other RCC lines (Fig 1C,D) RCC cells show decreased calcium uptake Improper folding may cause protein retention Importantly, calcium binding strongly affects TSP1 folding [24] In the case of pseudoachondroplasia, TSP5 mutations in the calcium-binding cassette alter its ability to transit endoplasmic reticulum (ER) and to undergo secretion [25,26] We hypothesized that different TSP1 secretion may result from different calcium availability in HNK and RCC cells We measured calcium uptake by the cells stimulated by VEGF: 10 ngỈmL)1 VEGF caused no measurable intake of Ca2+in RCC cells, whereas HNK cells developed a robust response (Fig 2A,B) Moreover, RCC cells responded poorly to Ionomycin, a potent Ca2+ ionophore, relative to HNK (Fig 2B) In addition, treatment of HNK with BAPTA-AM, a cell-permeating calcium chelator, caused a significant increase in cytoplasmic TSP1 and a concomitant decrease in secreted TSP1 (measured by western blot and immunostaining; Fig 2C,D) TSP1 appeared unique in this respect: 10 mm BAPTA-AM had no effect on the intracellular content and secretion of VEGF, but induced TSP1 retention and diminished secretion (Fig 2E) RCC expresses low TRPC4 and calbindin Seeking reasons for the altered calcium metabolism, we examined TRPCs, which mediate agonist-stimulated Ca2+ influx [27] Semiquantitative and real-time RT-PCR showed significant expression of TRPC1, TRPC4, TRPC6 and TRPC7 in HNK cells (Fig 3A,B) In RCC cells, TRPC4 expression was decreased four-fold (Fig 3A,B) TRPC4 expression and function are established in the vasculature, but not in the kidney Importantly, TRPC5, the TRPC4 analog, was not expressed in HNK or RCC cells (Fig 3A,B); thus, there was no functional redundancy HNK cells expressed high levels of the calcium-binding protein, calbindin D28K [28] (Fig 3C) In normal kidney, calbindins transport calcium ions across the glomerular epithelium and serve as buffers, to prevent toxic concentrations of intracellular calcium [29] Consistent with published data, RCC cells expressed no calbindin D28K, probably because of their poorly differentiated state (Fig 3C) Functional TRPC4 was indeed critical for TSP1 secretion: TRPC4 siRNA transfection of HNK cells caused an increase in cytoplasmic and a decrease in secreted TSP1 (Fig 3D) RCC cells retain TSP1 in the ER One possible consequence of misfolding is protein ‘recall’ to the ER from the ER–Golgi intermediate compartment (ERGIC), a site for concentrating retrograde cargo [30] Anterograde transport vesicles contain coatomer protein II (COPII), whereas retrograde vesicles contain COPI [31,32] In RCC cells and HNK cells treated with BAPTA-AM, TSP1 colocalized with ER markers, but not with Golgi, suggesting retrograde transport (Fig 4A–E) When HNK and p769 cells were subjected to h of serum deprivation to prompt secretion, fixed and stained for TSP1 and Sec23 (COPII component) or c2-Cop (COPI marker), TSP1 colocalized with Sec23 ⁄ COPII in HNK cells; colocalization with c2-Cop ⁄ COPI was minimal in HNK cells, FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6369 Thrombospondin-1 loss in renal cancer A D Veliceasa et al B C D E Fig Calcium uptake and mediators in HNK and RCC cells (A) Ca2+ uptake in response to VEGF by HNK and RCC cells HNK and RCC cells were preloaded with fluo-4 acetoxymethyl ester and treated with 10 ngỈmL)1 VEGF Ca2+ uptake was measured at 10 s intervals by videofluorescence imaging (B) Representative images of fluo-4 acetoxymethyl ester-loaded cells prior to and after VEGF exposure (C, D) Changes in TSP1 secretion ⁄ retention in response to the calcium chelator BAPTA-AM HNK cells were cultured for 12 h in serum-free medium with the indicated BAPTA-AM concentrations (C) The TSP1 content per milligram of protein was calculated using comparison with serial TSP1 dilutions (standard curve) on western blot (D) Representative blots of cell lysates (L, top, 20 lg per lane) and CM (CM, bottom, lg per lane) were collected in parallel experiments (E) HNK and P769 cells were cultured for 12 h with or without BAPTA-AM (1 nM) CM and lysates were collected as above and analyzed by western blotting Note the retention of TSP1 in the cytoplasm and decreased secretion by the BAPTA-AM-treated HNK cells Also note the higher VEGF levels in the cytoplasm and CM of P769 cells, and the lack of response to BAPTA-AM C, purified TSP1 or VEGF, respectively A B C D Fig Calcium channels and calbindin in HNK and P769 cells (A, B) mRNA levels for TRPC1–7 were evaluated in HNK and P769 cells by semiquantitative RT-PCR (A) or Q-PCR (B), using GAPDH message as control (C) Western blot for calbindin D28K (D) HNK cells were transfected with TRPC4 siRNA or scrambled control siRNA and cultured for 12 h in full medium After an additional 48 h in serum-free medium, RNA and CM were collected The silencing was ascertained by semiquantitative RT-PCR (approximately 45% decrease in the message level) Lysates (L) and CM were analyzed by western blotting for TSP1 content Note the cytoplasmic retention and decreased TSP1 secretion in HNK-siTRPC4 6370 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al Fig TSP1 localization in HNK and P769 cells (A) HNK cells were serum-starved to prompt secretion and treated with BAPTA-AM (1 lM), where indicated After 12 h, HNK cells were fixed, stained for TSP1 (green) and ER marker HSP-70 (red) Note the depletion of TSP1 from the cytoplasm of untreated cells (C, top) and accumulation in BAPTA-AM-treated cells (BAPTA-AM, bottom) (B–E) P769 and HNK cells were serum-starved for 24 h HNK cells were treated with BAPTA-AM to achieve TSP1 retention The cells were then stained for TSP1 as in (A), and for either Golgi marker A58 (B, C) or ER marker HSP-70 (D, E) Note the lack of TSP1 export in BAPTA-AM-treated HNK cells and colocalization (shown in yellow) with ER, but not with Golgi, in both RCC and BAPTA-AM-treated HNK cells Thrombospondin-1 loss in renal cancer A C BAPTA B indicating anterograde transport and secretion (Fig 5) By contrast, in p769 cells, TSP1 colocalized with c2-Cop ⁄ COPI, suggesting retrograde transport (Fig 5) Discussion Normal adult vasculature is quiescent as a result of the balanced expression of pro- and antiangiogenic factors [33,34] Multiple inducers of angiogenesis (VEGF, bFGF, IL-8, stromal cell-derived factor-1, etc.), when expressed at high levels, expand tumor vasculature [35] Most strategies target angiogenic stimuli, their receptors or receptor tyrosine kinase activity [36] However, an expanding pool of natural molecules act as brakes for angiogenesis [33] Similar to tumor suppressors, inhibitors are frequently lost in tumors, creating a permissive environment for expansion Re-expression of such inhibitors in angiogenic tumors impedes their progression: these include angiostatin, endostatin, tumstatin, PEDF, SPARC (secreted protein, acidic and rich in cysteine), tissue inhibitor of metalloproteinases (TIMPs) and TSP1 An emerging concept is to view natural angiogenesis inhibitors as endothelial-specific tumor suppressors [33] TSP1 is one of the most studied angiogenesis inhibitors [21], both in terms of regulation and mechanism of action It is lost in multiple tumor types: fibrosarcoma, glioblastoma and carcinomas of the breast, bladder, colon, prostate and thyroid [19] TSP1 expression is associated with dormancy of nonangiogenic tumors, and predicts a favorable outcome in multiple tumor types [37] It blocks angiogenesis via endothelial cell apoptosis, which requires receptors CD36 and Fas, and Fas ligand [38], and causes CD36-independent cell cycle arrest [39] TSP1 suppresses recruitment of the circulating endothelial progenitors [40] and signaling by nitric oxide (NO) [41] The causes of TSP1 loss vary They include genetic alterations, e.g the loss of tumor suppressor genes P769 C HNK D P769 E FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS HNK 6371 Thrombospondin-1 loss in renal cancer D Veliceasa et al A B Fig TSP1 association with retro- and anterograde transport vesicles The cells were starved for h to initiate secretion, fixed and stained for TSP1 (red) and for COPII component Sec23, a marker of anterograde vesicles, or with COPI component c2-COP, a marker of retrograde vesicles (green) Note the predominant TSP1 colocalization with Sec23 (anterograde vesicles) in normal HNK and with c2-COP (retrograde vesicles) in P769 tumor cells (APC, p53, PTEN, SMAD-4 and THY-1) [42–46] or the gain of activated oncogenes (Akt ⁄ PI-3K, Id-1, Jun, MCT-1, Mts1 ⁄ S100A4, Myc, Ras and Src) [47– 50] Some of these pathways interact: Ras can activate c-Myc [51], which acts via microRNA cluster miR-17-92 [52] Epigenetic events may also contribute: TSP1 can be repressed by anoxia [53] or hyperglycemia [54] A knowledge of the pathways altering TSP1 production may yield therapies to restore angiogenic balance and reduce or arrest tumor burden Our study yielded two findings First, the loss of secreted TSP1 contributed to angiogenesis by RCC cells in cooperation with the increase in VEGF Second, TSP1 secretion, which determines the state of the angiogenic switch, was impaired in RCC because of cytoplasmic retention, whilst healthy cells maintained normal secretion Seeking molecular causes of failure to secrete TSP1, we focused on misfolding caused by limited calcium availability [55] This was indeed the case: in RCC or BAPTA-AM-treated normal renal cells, TSP1 resided in the ER, and not in the Golgi apparatus In RCC cells, the analysis of transport 6372 vesicles showed strong TSP1 association with COPIpositive vesicles responsible for retrograde transport, a mechanism by which the cells ‘recall’ misfolded proteins from the ERGIC [56] By contrast, in HNK cells, TSP1 was localized predominantly in COPII-positive anterograde vesicles, pointing to Golgi accumulation prior to secretion Seeking reasons for impaired calcium metabolism, we found that RCC cells expressed lower levels of TRPC4, which, together with TRPC1, forms heteromeric channels [27] that mediate growth factor-stimulated calcium influx [27] Although TRPC4 expression in the renal epithelium has been shown, its role in renal tissue is unknown Our data indicate that TRPC4 is a key regulator of calcium intake in this tissue Further analysis showed that, in agreement with published data [57], most RCC cell lines expressed no detectable calbindin, possibly because of their undifferentiated state In addition to transepithelial calcium transport, calbindin acts as a buffer, absorbing excess calcium [28,29] The lack of calbindin increases apoptosis in response to growth factor-initiated calcium intake [58] Thus, TRPC4 reduction may be an adaptation of RCC cells to the lack of calbindin protective function The protection from apoptosis despite the lack of calbindin could be explained by the decrease in TRPC4, or by retention of the Ca2+-binding TSP1 However, TSP1 knockdown with siRNA had no effect on the viability of P769 cells (see supplementary Fig S1), suggesting that the loss of TRPC4 was sufficient to compensate for the lack of calbindin Therefore, we have demonstrated diminished TSP1 secretion by RCC cells as a result of active retrograde transport This active retrograde transport was triggered by protein misfolding, which, in turn, was caused by changes in calcium metabolism Calcium intake in response to growth stimuli was reduced because of the decrease in TRPC4 and the lack of calbindin This is a novel pathway by which cancer cells down-regulate TSP1, an angiogenesis inhibitor, and flip their angiogenic switch Further analysis of calcium metabolism and its modifiers may yield novel strategies to suppress RCC angiogenesis and growth Experimental procedures Cells and reagents Human renal epithelial cells (HNK, P3-8; Clonetics, Walkersville, MD) were grown in keratinocyte growth medium (Gibco Invitrogen, Carlsbad, CA) with 10% fetal bovine serum RCC cells (PRC9, SW839, p769; American Tissue FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al Type Culture Collection, Manassas, VA) and 786-O RCC expressing wild-type (WT8) or inactive VHL tumor suppressor (ARZ; a gift from R Kerbel, Sunnybrook and Women’s Hospital, Toronto, Canada) were maintained in keratinocyte growth medium with 10% fetal bovine serum HMVECs (Clonetics) were maintained in MDCB131 (Sigma, St Louis, MO) with the endothelial cell bullet kit (BioWhittaker, Walkersville, MD) BAPTA-AM, fluo-4 acetoxymethyl ester and Pluronic F127 were obtained from Molecular Probes (Invitrogen) VEGF and EGF were purchased from R&D Systems (Minneapolis, MN) TSP1 antibodies (Ab-1, Ab-3, Ab-11) were obtained from NeoMarkers (Fremont, CA) VEGF antibodies were purchased from R&D Systems A-58 monoclonal antibody was obtained from Sigma Antibodies for heat shock protein-70 (HSP-70), c2-Cop and Sec23 were obtained from Santa Cruz (Santa Cruz, CA, USA) and Calbindin D-28K from AbCam (Cambridge, MA) Fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG were purchased from Sigma Rhodamine (TRITC)-conjugated, horseradish peroxidase (HRP)-conjugated and Alexa Fluor-conjugated antibodies were obtained from Jackson Immunoresearch (Westgrove, PA) TSP1 was purified from platelets as described previously [59] CM preparation The cells were grown to 70–80% confluence, rinsed twice and transferred to serum-free medium After h, this medium was removed and replaced by fresh medium After 24–48 h, CM were collected and concentrated in centifugal filters (3 kDa cut-off; Millipore, Billerica, MA) Transfection TRPC4, TSP1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and scrambled siRNA were obtained from Dharmacon (Lafayette, CO) The cells were seeded in sixwell plates (4 · 105, · 105 and · 105 per well) in the growth medium siRNA in 200 lL of serum-free medium (100 nm final concentration) and DharmaFECT reagent (4 lL in 200 lL of serum-free medium) were incubated for 20 at room temperature and added to the cells After 24, 48 and 72 h, CM were collected and the cells were processed further (total RNA and ⁄ or cell lysates) Cell survival ⁄ proliferation assay The cells were seeded in a 96-well plate 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide reagent (Chemicon, Billerica, MA) was added at 24, 48 and 72 h and incubated for h at 37 °C The assay was performed following the manufacturer’s instructions Thrombospondin-1 loss in renal cancer Endothelial cell chemotaxis HMVECs starved overnight in MDCB131 with 0.1% BSA were plated at 1.5 · 106 mL)1 on the lower side of porous membranes (8 mm, Nucleopore Corp., Kent, WA) in modified Boyden chambers (Neuroprobe, Gaithersburg, MD); the samples were added to the top Cells migrating to the opposite side of the membrane were counted in · 10 400 fields (controls: 0.1% BSA, 10 ngỈmL)1 bFGF) Specific activity CM were tested as above, at 0.01–40 lgỈmL)1, to generate dose–response curves The ED50 values (concentrations producing 50% maximal response) were extrapolated from the best-fit curves (sigmaplot, Systat Software, San Jose, CA) To evaluate VEGF and TSP1 contributions, the appropriate neutralizing antibodies were added at 1.0 and 2.5 lgỈmL)1, respectively Corneal angiogenesis CM from HNK and RCC cell lines were analyzed in the rat or mouse corneal assay [60,61] Briefly, micropockets were aseptically created in the cornea of female Fisher 344 rats or C57Bl6 mice (Harlan), 1.5–2.0 mm and 0.5–1 mm from the limbus, respectively In rats, Hydron (HydroMed, Cranbury, NJ, USA) implants ( lL, lg CM protein) were placed in the micropockets and angiogenesis was scored on day Animals were perfused with colloidal carbon, and the corneas were fixed, flattened and photographed Vascular growth from the limbus to the pellet was graded as positive or negative In mice, Hydron sucralfate pellets (1 lL, 0.4 mg protein) were implanted and angiogenesis was scored on day by slit-lamp microscopy All animals were handled following the National Institutes of Health guidelines and protocols approved by the Northwestern University Animal Care and Use Committee Statistical evaluation Quantitative results were evaluated using Student’s t-test P < 0.05 was considered to be significant Tissue acquisition and staining Deidentified specimens were obtained from the pathology department with Institutional Review Board approval for archived tissues Five micrometer sections were stained with hematoxylin–eosin to select the areas of carcinoma and noncancerous tissue Sections were deparaffinized, rehydrated in graded ethanol solutions, treated for with 3% H2O2, rinsed and blocked for 30 in 10% FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6373 Thrombospondin-1 loss in renal cancer D Veliceasa et al Table Primers used in RT-PCR analysis Gene Primers (5¢- to 3¢) TGTTGGCGTACAGGTCTTTGC GCTACGAGCTGCCTGACGG GAPDH TATCGTGGAAGGACTCATGACC TACATGGCAACTGTGAGGGG TSP1 CCGGCGTGAAGTGTACTAGCTA TGCACTTGGCGTTCTTGT TRPC1 GATTTTGGAAAATTTCTTGGGATGT TTTGTCTTCATGATTTGCTATCA TRPC2 CATCATCAT-GGTCATTGTGCTGC GGTCTTGGTCAGCTCTGTGAGTC TRPC3 GACATATTCAAGTTCATGGTCCTC ACATCACTGTCATCCTCAATTTC TRPC4 GCTTTGTTCGTGCAAATTTCC CTGCAAATATCTCTGGGAAGA TRPC5 CAGCATTGCGTTCTGTGAAAC CAGAGCTATCGATGAGCCTAAC TRPC6 GACATCTTCAAGTTCATGGTCATA ATCAGCGTCATCCTCAATTTC TRPC7 CAGAAGATCGAGGACATCAGC GTGCCGGGCATTCACGTGGTA Actin Annealing Cycle T (°C) number acquired with a Hamamatsu (Bridgewater, NJ) camera (10 s intervals, openlab software, Improvision, Waltham, MA) and analyzed with imagej software (minimum of 30 cells per treatment) 60 23 55 20 RT-PCR 65 25 55 35 55 35 55 35 55 35 One microgram of total RNA extracted with an RNeasy kit (Qiagen, Valencia, CA) was used for reverse transcription with oligo(dT)15 primers (protocol and reagents from Promega, Madison, WI) Serial dilutions of cDNA were PCR-amplified in a 23-cycle reaction with b-actin primers (HotStartTaqTM, Qiagen) Dilutions yielding similar product amounts were chosen for analysis; products were resolved on 1.5% agarose gels Primers ⁄ conditions are given in Table 55 35 55 35 55 35 horse serum at room temperature The sections were incubated with TSP1 antibodies in blocking solution (Ab-1, : 250, °C overnight), followed by rabbit anti-mouse IgG (Vectastain ABC kit, Vector, Burlingham, CA, : 125, h at room temperature), rinsed and incubated with avidin– biotin complex (Vectastain; h, room temperature) Slides were developed with 2,4-diaminobutyric acid, counterstained with hematoxylin, rehydrated and mounted Western blotting To detect TSP1, the cells were lysed for h at °C in 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS and 150 mm NaCl in 10 mm sodium phosphate pH 7.2, with protease inhibitors The lysates were loaded at 30 lg per lane; concentrated CM were loaded at 10 lg per lane The blots were probed with TSP1 Ab-11 (1 : 400), and the signal was detected with a LumiGLO Kit (KPL, Gaithersburg, MD) Calbindin antibodies (1 : 5000) were applied overnight (4 °C) Immunofluorescence Cells grown on coverslips were fixed in ice-cold methanol– acetone (1 : 1) and blocked for 30 (1% horse serum) To detect TSP1, the cells were incubated for h at room temperature with Ab-1 (1 : 50 in blocking solution), followed by the Alexa Fluor 488 goat anti-mouse IgM (5 lgỈmL)1 in blocking solution) A-58 Golgi protein antibody (1 : 500) was followed by goat anti-mouse TRITCIgG (1 : 100) ER marker antibody, HSP-70 (1 : 100), was followed by Alexa Fluor 546 goat anti-mouse IgG (5 lgỈmL)1) To analyze TSP1 localization to transport vesicles, the slides were blocked for 30 in 10% donkey serum and incubated with TSP1 Ab-3 (1 : 50) and Sec23 or c2-Cop antibodies (1 : 50) in 2% donkey serum for h at room temperature The slides were rinsed three times and incubated for h with FITC-conjugated donkey anti-mouse IgG and Texas Red conjugated donkey anti-goat IgG (1 : 100, 2% donkey serum) The slides were mounted in Fluoromount-G Acknowledgements This work was funded by National Institutes of Health (NIH) grant RO1 HL077471 (OV) References Calcium imaging Intracellular calcium was detected by videofluorescence imaging Cells were grown on chamber slides, rinsed in Hank’s balanced salt solution, 10 mm Hepes, 11 mm glucose, 2.5 mm CaCl2 and 1.2 mm MgCl2, loaded for 30 in lm fluo-4 acetoxymethyl ester, Pluronic F127 (1 : 1, Molecular Probes), treated and monitored (488 nm excitation, 520 nm emission) with a fluorescent microscope (Leica, Bannockburn, IL, · 20 objective) Images were 6374 Brugarolas J (2007) Renal-cell carcinoma – molecular pathways and therapies N Engl J Med 356, 185–187 Kim WY & Kaelin WG (2004) Role of VHL gene mutation in human cancer J Clin Oncol 22, 4991–5004 Kaelin WG Jr (2003) The von Hippel–Lindau gene, kidney cancer, and oxygen sensing J Am Soc Nephrol 14, 2703–2711 Semenza GL (2003) Targeting HIF-1 for cancer therapy Nat Rev Cancer 3, 721–732 FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al Yang JC (2004) Bevacizumab for patients with metastatic renal cancer: an update Clin Cancer Res 10, 6367S–6370S Motzer RJ & Bukowski RM (2006) Targeted therapy for metastatic renal cell carcinoma J Clin Oncol 24, 5601–5608 Kurban G, Hudon V, Duplan E, Ohh M & Pause A (2006) Characterization of a von Hippel Lindau pathway involved in extracellular matrix remodeling, cell invasion, and angiogenesis Cancer Res 66, 1313–1319 Garkavtsev I, Kozin SV, Chernova O, Xu L, Winkler F, Brown E, Barnett GH & Jain RK (2004) The candidate tumour suppressor protein ING4 regulates brain tumour growth and angiogenesis Nature 428, 328–332 Mestas J, Burdick MD, Reckamp K, Pantuck A, Figlin RA & Strieter RM (2005) The role of CXCR2 ⁄ CXCR2 ligand biological axis in renal cell carcinoma J Immunol 175, 5351–5357 10 Pan J, Burdick MD, Belperio JA, Xue YY, Gerard C, Sharma S, Dubinett SM & Strieter RM (2006) CXCR3 ⁄ CXCR3 ligand biological axis impairs RENCA tumor growth by a mechanism of immunoangiostasis J Immunol 176, 1456–1464 11 Cenni E, Perut F, Granchi D, Avnet S, Amato I, Brandi ML, Giunti A & Baldini N (2007) Inhibition of angiogenesis via FGF-2 blockage in primitive and bone metastatic renal cell carcinoma Anticancer Res 27, 315–319 12 Kedar D, Baker CH, Killion JJ, Dinney CP & Fidler IJ (2002) Blockade of the epidermal growth factor receptor signaling inhibits angiogenesis leading to regression of human renal cell carcinoma growing orthotopically in nude mice Clin Cancer Res 8, 3592–3600 13 Inoue K, Kamada M, Slaton JW, Fukata S, Yoshikawa C, Tamboli P, Dinney CP & Shuin T (2002) The prognostic value of angiogenesis and metastasis-related genes for progression of transitional cell carcinoma of the renal pelvis and ureter Clin Cancer Res 8, 1863– 1870 14 Slaton JW, Inoue K, Perrotte P, El-Naggar AK, Swanson DA, Fidler IJ & Dinney CP (2001) Expression levels of genes that regulate metastasis and angiogenesis correlate with advanced pathological stage of renal cell carcinoma Am J Pathol 158, 735–743 15 Abramson LP, Browne M, Stellmach V, Doll J, Cornwell M, Reynolds M, Arensman RM & Crawford SE (2006) Pigment epithelium-derived factor targets endothelial and epithelial cells in Wilms’ tumor J Pediatr Surg 41, 1351–1356 16 Huang J, Soffer SZ, Kim ES, Yokoi A, Moore JT, Mc Crudden KW, Manley C, Middlesworth W, O’Toole K, Stolar C et al (2002) p53 accumulation in favorablehistology Wilms tumor is associated with angiogenesis and clinically aggressive disease J Pediatr Surg 37, 523–527 Thrombospondin-1 loss in renal cancer 17 Raugi GJ & Lovett DH (1987) Thrombospondin secretion by cultured human glomerular mesangial cells Am J Pathol 129, 364–372 18 Miyata Y, Koga S, Takehara K, Kanetake H & Kanda S (2003) Expression of thrombospondin-derived 4N1K peptide-containing proteins in renal cell carcinoma tissues is associated with a decrease in tumor growth and angiogenesis Clin Cancer Res 9, 1734–1740 19 Lawler J (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth J Cell Mol Med 6, 1–12 20 Volpert OV (2000) Modulation of endothelial cell survival by an inhibitor of angiogenesis thrombospondin-1: a dynamic balance Cancer Metastasis Rev 19, 87–92 21 Ren B, Yee KO, Lawler J & Khosravi-Far R (2006) Regulation of tumor angiogenesis by thrombospondin1 Biochim Biophys Acta 1765, 178–188 22 Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL & Bouck N (2000) Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1 Nat Med 6, 41–48 23 Bocci G, Francia G, Man S, Lawler J & Kerbel RS (2003) Thrombospondin 1, a mediator of the antiangiogenic effects of low-dose metronomic chemotherapy Proc Natl Acad Sci USA 100, 12917–12922 24 Adams JC (2004) Functions of the conserved thrombospondin carboxy-terminal cassette in cell–extracellular matrix interactions and signaling Int J Biochem Cell Biol 36, 1102–1114 25 Dinser R, Zaucke F, Kreppel F, Hultenby K, Kochanek S, Paulsson M & Maurer P (2002) Pseudoachondroplasia is caused through both intra- and extracellular pathogenic pathways J Clin Invest 110, 505–513 26 Unger S & Hecht JT (2001) Pseudoachondroplasia and multiple epiphyseal dysplasia: new etiologic developments Am J Med Genet 106, 244–250 27 Desai BN & Clapham DE (2005) TRP channels and mice deficient in TRP channels Pflugers Arch 451, 11–18 28 Lambers TT, Bindels RJ & Hoenderop JG (2006) Coordinated control of renal Ca2+ handling Kidney Int 69, 650–654 29 Hemmingsen C (2000) Regulation of renal calbindinD28K Pharmacol Toxicol 87 (Suppl 3), 5–30 30 Behnia R & Munro S (2005) Organelle identity and the signposts for membrane traffic Nature 438, 597–604 31 Watson P & Stephens DJ (2005) ER-to-Golgi transport: form and formation of vesicular and tubular carriers Biochim Biophys Acta 1744, 304–315 32 Mancias JD & Goldberg J (2005) Exiting the endoplasmic reticulum Traffic 6, 278–285 33 Nyberg P, Xie L & Kalluri R (2005) Endogenous inhibitors of angiogenesis Cancer Res 65, 3967–3979 34 Sund M, Zeisberg M & Kalluri R (2005) Endogenous stimulators and inhibitors of angiogenesis in FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6375 Thrombospondin-1 loss in renal cancer 35 36 37 38 39 40 41 42 43 44 45 46 47 48 D Veliceasa et al gastrointestinal cancers: basic science to clinical application Gastroenterology 129, 2076–2091 Carmeliet P (2003) Angiogenesis in health and disease Nat Med 9, 653–660 Carmeliet P (2004) Manipulating angiogenesis in medicine J Intern Med 255, 538–561 Naumov GN, Akslen LA & Folkman J (2006) Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch Cell Cycle 5, 1779–1787 Volpert OV, Zaichuk T, Zhou W, Reiher F, Ferguson TA, Stuart PM, Amin M & Bouck NP (2002) Inducerstimulated Fas targets activated endothelium for destruction by antiangiogenic thrombospondin-1 and pigment epithelium-derived factor Nat Med 8, 349–357 Armstrong LC & Bornstein P (2003) Thrombospondins and function as inhibitors of angiogenesis Matrix Biol 22, 63–71 Shaked Y, Bertolini F, Man S, Rogers MS, Cervi D, Foutz T, Rawn K, Voskas D, Dumont DJ, Ben-David Y et al (2005) Genetic heterogeneity of the vasculogenic phenotype parallels angiogenesis; implications for cellular surrogate marker analysis of antiangiogenesis Cancer Cell 7, 101–111 Isenberg JS, Jia Y, Fukuyama J, Switzer CH, Wink DA & Roberts DD (2007) Thrombospondin-1 inhibits nitric oxide signaling via CD36 by inhibiting myristic acid uptake J Biol Chem 282, 15404–15415 Gutierrez LS, Suckow M, Lawler J, Ploplis VA & Castellino FJ (2003) Thrombospondin – a regulator of adenoma growth and carcinoma progression in the APC (Min ⁄ +) mouse model Carcinogenesis 24, 199– 207 Dameron KM, Volpert OV, Tainsky MA & Bouck N (1994) Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1 Science 265, 1582–1584 Wen S, Stolarov J, Myers MP, Su JD, Wigler MH, Tonks NK & Durden DL (2001) PTEN controls tumorinduced angiogenesis Proc Natl Acad Sci USA 98, 4622–4627 Schwarte-Waldhoff I & Schmiegel W (2002) Smad4 transcriptional pathways and angiogenesis Int J Gastrointest Cancer 31, 47–59 Abeysinghe HR, Li LQ, Guckert NL, Reeder J & Wang N (2005) THY-1 induction is associated with up-regulation of fibronectin and thrombospondin-1 in human ovarian cancer Cancer Genet Cytogenet 161, 151–158 Chen J, Somanath PR, Razorenova O, Chen WS, Hay N, Bornstein P & Byzova TV (2005) Akt1 regulates pathological angiogenesis, vascular maturation and permeability in vivo Nat Med 11, 1188–1196 Mettouchi A, Cabon F, Montreau N, Vernier P, Mercier G, Blangy D, Tricoire H, Vigier P & Binetruy B (1994) SPARC and thrombospondin genes are repressed by the c-jun oncogene in rat embryo fibroblasts Embo J 13, 5668–5678 6376 49 Levenson AS, et al (2005) MCT-1 oncogene contributes to increased in vivo tumorigenicity of MCF7 cells by promotion of angiogenesis and inhibition of apoptosis Cancer Res 65, 10651–10656 50 Schmidt-Hansen B, et al (2004) Functional significance of metastasis-inducing S100A4 (Mts1) in tumor–stroma interplay J Biol Chem 279, 24498–24504 51 Watnick RS, Cheng YN, Rangarajan A, Ince TA & Weinberg RA (2003) Ras modulates Myc activity to repress thrombospondin-1 expression and increase tumor angiogenesis Cancer Cell 3, 219–231 52 Dews M, et al (2006) Augmentation of tumor angiogenesis by a Myc-activated microRNA Cluster Nat Genet 38, 1060–1065 53 Tenan M, et al (2000) Thrombospondin-1 is downregulated by anoxia and suppresses tumorigenicity of human glioblastoma cells J Exp Med 191, 1789–1798 54 Sheibani N, Sorenson CM, Cornelius LA & Frazier WA (2000) Thrombospondin-1, a natural inhibitor of angiogenesis, is present in vitreous and aqueous humor and is modulated by hyperglycemia Biochem Biophys Res Commun 267, 257–261 55 Misenheimer TM & Mosher DF (1995) Calcium ion binding to thrombospondin J Biol Chem 270, 1729– 1733 56 Lee MC, Miller EA, Goldberg J, Orci L & Schekman R (2004) Bi-directional protein transport between the ER and Golgi Annu Rev Cell Dev Biol 20, 87–123 57 Bhat HK & Epelboym I (2004) Suppression of calbindin D28K in estrogen-induced hamster renal tumors J Steroid Biochem Mol Biol 92, 391–398 58 Parkash J, Chaudhry MA & Rhoten WB (2004) Calbindin-D28k and calcium sensing receptor cooperate in MCF-7 human breast cancer cells Int J Oncol 24, 1111–1119 59 Volpert OV, Lawler J & Bouck NP (1998) A human fibrosarcoma inhibits systemic angiogenesis and the growth of experimental metastases via thrombospondin-1 Proc Natl Acad Sci USA 95, 6343–6348 60 Good DJ, Polverini PJ, Rastinejad F, Le Beau MM, Lemons RS, Frazier WA & Bouck NP (1990) A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin Proc Natl Acad Sci USA 87, 6624–6628 61 Kenyon BM, Voest EE, Chen CC, Flynn E, Folkman J & D’Amato RJ (1996) A model of angiogenesis in the mouse cornea Invest Ophthalmol Vis Sci 37, 1625–1632 Supplementary material The following supplementary material is available online: Fig S1 P769 cells in 6-well plates (2500 cells/well) were transfected with TSP1 siRNA (Dharmacon) or FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS D Veliceasa et al control (scrambled siRNA) At 24, 48 and 72 h the number of viable cells was detected using MTT assay Note that P769-siTSP (dark blue) does not differ significantly from P769-siSCR (pink) This material is available as part of the online article from http://www.blackwell-synergy.com Thrombospondin-1 loss in renal cancer Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6377 ... peptide-containing proteins in renal cell carcinoma tissues is associated with a decrease in tumor growth and angiogenesis Clin Cancer Res 9, 17 34? ??1 740 19 Lawler J (2002) Thrombospondin-1 as an... and inhibitors of angiogenesis in FEBS Journal 2 74 (2007) 6365–6377 ª 2007 The Authors Journal compilation ª 2007 FEBS 6375 Thrombospondin-1 loss in renal cancer 35 36 37 38 39 40 41 42 43 44 ... 12917–12922 24 Adams JC (20 04) Functions of the conserved thrombospondin carboxy-terminal cassette in cell? ??extracellular matrix interactions and signaling Int J Biochem Cell Biol 36, 1102–11 14 25 Dinser