Bài viết Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên được nghiên cứu này nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên.
Vietnam J Agri Sci 2022, Vol 20, No 7: 911-919 Tạp chí Khoa học Nơng nghiệp Việt Nam 2022, 20(7): 911-919 www.vnua.edu.vn Trương Quang Lâm*, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Phịng Thí nghiệm trọng điểm Cơng nghệ sinh học Thú y, Khoa Thú y, Học viện Nông nghiệp Việt Nam * Tác giả liên hệ: tqlam@vnua.edu.vn Ngày nhận bài: 12.10.2021 Ngày chấp nhận đăng: 05.07.2022 TÓM TẮT Mục tiêu nghiên cứu nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên Tổng số 52 mẫu bệnh phẩm lợn nghi nhiễm bệnh sử dụng để xác định tỷ lệ nhiễm vi khuẩn M hyorhinis phương pháp PCR Kết nghiên cứu cho thấy tỷ lệ nhiễm vi khuẩn M hyorhinis lợn nghi mắc bệnh huyện tỉnh Hưng Yên tương đối cao chiếm tỷ lệ 26,92%, tỷ lệ nhiễm Khối Châu 31,82%, Văn Giang 25,00% Yên Mỹ 21,43% Tỷ lệ nhiễm vi khuẩn M hyorhinis lợn 5-10 tuần tuổi cao với 29,41% lợn > 10 tuần tuổi 28,57%, lợn < tuần tuổi tỷ lệ nhiễm thấp 21,43% Nghiên cứu xác định tỷ lệ đồng nhiễm M hyorhinis với M hyopneumoniae chiếm 28,57%, H parasuis 35,71% S suis 21,43% Kết so sánh bệnh tích đại thể, sử dụng phương pháp PCR cho thấy lợn bệnh dương tính với vi khuẩn M hyorhinis có đặc điểm bệnh lý điển hình với viêm dính màng ngồi phủ fibrin Từ khóa: M hyorhinis, tỷ lệ nhiễm, PCR, Hưng Yên Exploring Prevalence of Mycoplasma hyorhinis Infection by PCR Method in Pigs Raised in Hung Yen Province ABSTRACT The aim of this study was to determine the infection rate of Mycoplasma hyorhinis from suspected pigs in Khoai Chau, Van Giang, and Yen My districts of Hung Yen province A total of 52 clinical samples of suspected pigs were used to determine the infection rate of M hyorhinis by using the PCR method The results showed that the infection rate of M hyorhinis in districts in Hung Yen province was relatively high at 26.92%, in which infection rate was recorded in Khoai Chau with 31.82%, Van Giang 25.00% and Yen My 21.43% The rate of infection with M hyorhinis in pigs at 5-10 weeks of age was the highest at 29.41% and was similar to pigs >10 weeks old 28.57%, while pigs < weeks old showed lowest infection rate 21.43% Research also determined that the rate of co-infection of M hyorhinis with M hyopneumoniae accounted for 28.57%, H parasuis 35.71% and S suis 21.43% Comparison of macroscopic findings and PCR results showed that pigs infected with M hyorhinis exhibited the main pathological feature with a severe fibrinous pericarditis Keywords: M hyorhinis infection in pigs, prevalence, PCR, Hung Yen province 911 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn nuôi tỉnh Hưng Yên 912 Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh µ µ µ µ µ Phát vi khuẩn M hyopneumoniae Trình tự mồi Sản phẩm (bp) Tài liệu tham khảo ACTAGATAGGAAATGCTCTAG 430 Barate & cs., 2012 821 Oliveira S & cs., 2001 688 Okwumabua & cs., 2003 ATACTACTCAGGCGGATCATTTAAC H parasuis GTGATGAGGAAGGGTGGTGT S suis GCAGCGTATTCTGTCAAACG GGCTTCGTCACCCTCTGTA CCATGGACAGATAAAGATGG 913 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn ni tỉnh Hưng n Chu trình nhiệt phản ứng PCR Phát vi khuẩn Tiền biến tính M hyopneumoniae 94C/3 phút Biến tính 94C/30 giây chu kỳ H parasuis 94C/5 phút 94C/5 phút 94C/30 giây 914 50C/45 giây Kéo dài 72C/1 phút 72C/7 phút chu kỳ 56C/1 phút 72C/90 giây 72C/7 phút 30 chu kỳ 94C/30 giây chu kỳ Huyện Tổng hợp 35 chu kỳ chu kỳ S suis Bắt cặp chu kỳ 57,3C/1phút 72C/90 giây 72C/6 phút 30 chu kỳ Số lợn kiểm tra chu kỳ Số lợn dương tính Tỷ lệ (%) Khoái Châu 22 31,82 Văn Giang 16 25,00 Yên Mỹ 14 21,43 Tổng 52 14 26,92 Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Đối tượng lợn theo dõi (tuần tuổi) Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) 10 21 28,57 Tổng 52 14 26,92 915 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn nuôi tỉnh Hưng Yên Đối tượng lợn theo dõi (tuần tuổi) M hyorhinis 10 Tổng 916 14 M hyopneumoniae H parasuis S suis 1/3 1/3 0/3 (33,33%) (33,33%) (0%) 2/5 2/5 2/5 (40,00%) (40,00%) (40,00%) 1/6 2/6 1/6 (16,67%) (33,33%) (16,67%) 4/14 5/14 3/14 (28,57%) (35,71%) (21,43%) Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh 917 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn nuôi tỉnh Hưng Yên Abhijit K Barate, Hwi-Young Lee, Hye-Won Jeong, Lam Quang Truong, Hong-Gu Joo & Tae-Wook Hahn (2012) An improved multiplex PCR for diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis Korean Journal of Veterinary Research 52(1):39-43 Boetner A.G., Binder M & Bille-Hansen V (1987) Streptococcus suis infections in Danish pigs and experimental infection with Streptococcus suis serotype Acta Pathol Microbiol Immunol Scand B 95: 233-239 Caron J., Ouardani M & Dea S (2000) Diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections in pigs by PCR amplification of the p36 and p46 genes J Clin Microbiol 38: 1390-1396 918 Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Gois M., Kuksa F & Sisak F (1977) Experimental infection of gnotobiotic piglets with Mycoplasma hyorhinis and Bordetella bronchiseptica Zentralbl Veterinarmed B24: 89-96 Huỳnh Thị Mỹ Lệ, Tạ Thị Kim Chung, Vũ Thị Ngọc, Cao Thị Bích Phượng & Chu Thị Thanh Hương (2018) Ứng dụng phản ứng Multiplex Nested PCR để phát Haemophilus parasuis, Mycoplasma hyorhinis Streptococcus suis gây bệnh viêm đa mạc lợn Kỷ yếu Hội thảo khoa học nữ cán viên chức Nhà xuất Học viện Nông nghiệp tr 167-175 Kang I., Kim D., Han K., Seo H.W., Oh Y., Park C., Lee J., Gottschalk M & Chae C (2012) Optimized protocol for multiplex nested polymerase chain reaction to detect and differentiate Haemophilus parasuis, Streptococcus suis, and Mycoplasma hyorhinis in formalin-fixed, paraffin-embedded tissues from pigs with polyserositis Canadian Journal of Veterinary Research 76: 195-200 Lee J.A., Oh Y.R., Hwang M.A., Lee J.B., Park S.Y., Song C.S & Lee S.W (2016) Mycoplasma hyorhinis is a potential pathogen of porcine respiratory disease complex that aggravates pneumonia caused by porcine reproductive and respiratory syndrome virus Veterinary Immunology and Immunopathology 177: 48-51 Lin J.H., Chen S.P., Yeh K.S & Weng C.N (2006) Mycoplasma hyorhinis in Taiwan: Diagnosis and isolation of swine pneumonia pathogen Vet Microbiol 115: 111-116 Lobo E., Poveda C., Gupta R., Suarez A., Hernández Y., Ramírez A & Poveda J.B (2011) Mycoplasmas hyorhinis in different regions of Cuba Diagnosis Braz J Microbiol 42: 721-725 Luehrs A., Siegenthaler S., Grützner N., Grosse Beilage E., Kuhnert P & Nathues H (2017) Occurrence of Mycoplasma hyorhinis infections in fattening pigs and association with clinical signs and pathological lesions of Enzootic Pneumonia Vet Microbiol 203: 1-5 Miranda-Morales R.E., Trejo V.R., López-Cerino L.E., Carrillo-Casas E.M., Sarmiento-Silva R.E., Trujillo-Ortega M.E., Figueroa R.B & Trigo-Tavera F.J (2020) Frequency of M hyopneumoniae, M hyorhinis and M hyosynoviae in nasal and lung samples from pigs with symptoms of porcine enzootic pneumonia Revista Mexicana de Ciencias Pecuarias 11(4): 946-960 Morita T., Ohiwa S., Shimada A., Kazama S., Yagihashi T & Umemura T (1999) Intranasally inoculated Mycoplasma hyorhinis causes eustachitis in pigs Vet 82 Pathol 36: 174-178 Morita T., Sasaki A., Kaji N., Shimada A., Kazama S., Yagihashi T., Umemura T (1998) Induction of temporary otitis media in specific-pathogen-free pigs by intratympanic inoculation of Mycoplasma hyorhinis Am J Vet Res 59: 869-873 Okwumabua O., O'Connor M & Shull E (2003) A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase FEMS Microbiol Lett 218(1): 79-84 Oliveira S., Galina L & Pijoan C (2001) Development of a PCR test to diagnose Haemophilus parasuis infections J Vet Diagn Invest 13(6): 495-501 Pallarés F.J., Halbur P.G., Schmitt C.S., Roth J.A., Opriessnig T., Thomas P.J., Kinyon J.M., Murphy D., Frank D.E & Hoffman L.J (2003) Comparison of experimental models for Streptococcus suis infection of conventional pigs Canadian Journal of Veterinary Research 67: 225-228 Riley M.G., Russell E.G & Callinan R.B (1977) Haemophilus parasuis infection in swine J Am Vet Med Assoc 171(7):649-51 919 ... lợn theo dõi (tuần tuổi) Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) 10 21 28,57 Tổng 52 14 26,92 915 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn nuôi tỉnh. .. GGCTTCGTCACCCTCTGTA CCATGGACAGATAAAGATGG 913 Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn ni tỉnh Hưng n Chu trình nhiệt phản ứng PCR Phát vi khuẩn Tiền biến tính M hyopneumoniae 94C/3.. .Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis lợn nuôi tỉnh Hưng Yên 912 Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị