Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf

Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant Martin Lehmann 1 , Simone Degen 1 , Hans-Peter Hohmann 1 , Markus Wyss 1 , Adelbert Bacher 2 and Nicholas Schramek 2 1 DSM Nutritional Products Ltd., Basel, Switzerland 2 Lehrstuhl fu ¨ r Biochemie, Technische Universita ¨ tMu ¨ nchen, Lichtenbergstr, Garching, Germany Introduction More than 3000 metric tons of vitamin B 2 (riboflavin; 6) are produced per year for use in human nutrition, animal husbandry and as a food colorant. In recent years, efficient fermentation processes have replaced chemical synthesis for manufacturing the vitamin [1,2]. The biosynthetic pathway of riboflavin has been studied in considerable detail [3–6]. Briefly, GTP is converted into 2,5-diamino-6-ribosylamino-4(3H)-pyri- midinone 5¢-phosphate (2) by the catalytic action of GTP cyclohydrolase II (Fig. 1) [7]. The product is transformed into 5-amino-6-ribitylamino-2,4(1H,3H)- pyrimidinedione (3) by a sequence of side-chain reduc- tion, deamination and dephosphorylation. Condensa- tion of 3 with 3,4-dihydroxy-2-butanone 4-phosphate (4) results in the production of 6,7-dimethyl-8-ribityl- lumazine (5) [8,9]. An unusual dismutation catalyzed by riboflavin synthase converts the lumazine derivative into an equimolar mixture of riboflavin (6) and the pyrimidine 3 which is re-utilized by the lumazine synthase [10–13]. With the exception of the elusive phosphatase, all enzymes of the pathway have been studied at least in some detail. The enzymes of the riboflavin pathway are generally characterized by low catalytic rates. This is not surprising Keywords biotechnology; directed evolution; GTP cyclohydrolase; riboflavin biosynthesis; vitamin B 2 production Correspondence N. Schramek, Lehrstuhl fu ¨ r Biochemie, Technische Universita ¨ tMu ¨ nchen, Lichtenbergstr. 4, D-85747 Garching, Germany Tel: +49 089 289 13336 Fax: +49 089 289 13363 E-Mail: nicholas.schramek@ch.tum.de (Received 16 March 2009, Revised 24 May 2009, accepted 28 May 2009) doi:10.1111/j.1742-4658.2009.07118.x GTP cyclohydrolase II catalyzes the first dedicated step in the biosynthesis of riboflavin and appears to be a limiting factor for the production of the vitamin by recombinant Bacillus subtilis overproducer strains. Using error- prone PCR amplification, we generated a library of the B. subtilis ribA gene selectively mutated in the GTP cyclohydrolase II domain. The ratio of the GTP cyclohydrolase II to 3,4-dihydroxy-2-butanone synthase activities of the mutant proteins was measured. A mutant designated Construct E, carrying seven point mutations, showed a two-fold increase in GTP cyclo- hydrolase II activity and a four-fold increase in the K m value with GTP as the substrate. Using the analog 2-amino-5-formylamino-6-ribosylamino- 4(3H)-pyrimidinone 5¢-triphosphate as the substrate, the mutant showed a rate enhancement by a factor of about two and an increase in the K m value by a factor of about 5. A series of UV absorption spectra obtained in stopped-flow experiments using the wild-type and mutant enzymes revealed isosbestic points indicative of apparently perfect reactions, which were simi- lar to the findings obtained with GTP cyclohydrolase II of Escherichia coli. Initial burst velocities obtained for the mutant and wild-type proteins were similar. The data suggest that the mutations present in Construct E are jointly conducive to the acceleration of a late step in the reaction trajec- tory, most probably the release of product from the enzyme. Abbreviation DHB, 3,4-dihydroxy-2-butanone. FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4119 in light of the small amounts of the trace metabolite that are required for metabolism and growth. These low rates constitute a problem for the further improve- ment of riboflavin fermentation processes. Studies on a riboflavin producer strain of Bacil- lus subtilis showed a significant increase in productivity following the insertion of an additional gene copy of ribA, suggesting that this enzyme constitutes a bottle- neck in the pathway [14]. The complex reaction mechanism of GTP cyclohy- drolase II has been studied using spectroscopic and kinetic methods. Notably, the enzyme catalyzes the release of C-8 from the imidazole moiety of GTP as formate and also the release of inorganic diphosphate from the ribose side-chain (Fig. 2). As a side reaction, a fraction of the substrate, GTP, is converted into GMP (11) by release of pyrophosphate without con- comitant ring opening. Kinetic studies suggested that the first reaction step of the enzyme-catalyzed trajec- tory is the covalent guanylation of the enzyme under release of pyrophosphate [12]. Carbon 8 of the purine system of intermediate 8 is then hydrolytically released, and the reaction is terminated by hydrolysis of the phosphodiester bond between the covalently bound intermediate 9 and the protein. This article describes studies directed at an increase in the overall reaction rate of GTP cyclohydrolase II. Results Whereas most enzymes of the riboflavin biosynthetic pathway have low catalytic rates, the activity of GTP cyclohydrolase II appears to be rate limiting for the overall productivity of a recombinant B. subtilis strain [14]. Both initial steps of the convergent riboflavin bio- synthetic pathway are catalyzed in B. subtilis by the bifunctional RibA protein comprising a GTP cyclohy- drolase II and a 3,4-dihydroxy-2-butanone 4-phosphate domain on the same subunit. In order to increase selec- tively the GTP cyclohydrolase II activity, the gene seg- ment specifying the cognate protein domain was subjected to in vitro mutagenesis by error-prone PCR (on average, two to five mutations per gene), and the resulting amplificates were ligated to the gene segment specifying the 3,4-dihydroxy-2-butanone 4-phosphate domain (that had not been subjected to mutagenesis). The resulting, mutated genes were ligated into the expression plasmid pQE60 and transformed into an Escherichia coli strain carrying a ribA ) mutation (Fig. 3). Growth occurred only if the mutated ribA A B C D E Fig. 1. Pathway of riboflavin biosynthesis. (A) GTP cyclohydrolase II. (B) Sequence of deaminase, reductase and phosphatase. (C) 3,4-Dihydroxy-2-butanone 4-phosphate synthase. (D) 6,7-Dimethyl-8-ribityllumazin synthase. (E) Riboflavin synthase. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al. 4120 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS gene specified a recombinant protein that retained sig- nificant GTP cyclohydrolase II activity. The library of recombinant E. coli strains afforded a library of mutant proteins that was assayed for GTP cyclohydrolase II and 3,4-dihydroxy-2-butanone 4-phosphate synthase activities. Mutant proteins with a relative increase in GTP cyclohydrolase II activity (compared with the 3,4- dihydroxy-2-butanone 4-phosphate synthase activity) were purified; purification was facilitated by the pres- ence of a polyhistidine tag at the N-terminus. A total of 3300 recombinant E. coli strains were screened and provided nine candidate strains with apparent enhancements in GTP cyclohydrolase II activ- ity; the largest enhancements observed were in the range of 1.5-fold. Combination of the gene mutations of the most improved mutant genes A#1 G2 (T203S, A290T, A296T) and A#4 C9 (K195T, V264A, V275A, K397E) did not result in a further improved mutant. Numbering of the amino acid residues included the 14 amino acids of the His-tag. The original start methio- nine of RibA became amino acid residue 15. The neutral mutation, T203S, of A#1 G2, was removed, and mutation Y210C, which was found in another mutant of the library, was introduced in return. By SDS gel chromatography it became apparent that the Fig. 2. Hypothetical reaction mechanism of GTP cyclohydrolase II [13]. mrgshhhhhhgidh Fig. 3. Generation of the cyclohydrolase II mutant library. The DHB synthase and cyclohydrolase II domains were separately amplified by PCR to permit the integration of random mutations only into the cyclohydrolase II domain. Afterwards, the two PCR products were combined by a third PCR, digested by EcoRI and BamHI, and trans- formed into the cyclohydrolase II-deficient E. coli strain Rib7 (pREP4). M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4121 mutation reduced the susceptibility to proteolytic cleveage into two typical fragments of the RibA wild- type protein. The new mutant (Y210C, A290T, A296T) was used as template for a second cycle of mutagenesis and selection (10 000 mutants). It afforded 351 novel candidate strains. After rescreening, 10 mutant proteins were purified and characterized, and their effective mutations were determined. The best combinations of the newly found mutations resulted in Constructs C (Y210C, A290T, Q293R, A296T, K322R, M361I) and E (Y210C, A290T, Q293R, A296T, K322R, F339Y, M361I), which were selected for more detailed kinetic studies. Steady-state kinetic experiments were conducted at pH 8.5 and 30 °C. The reaction was monitored photo- metrically at 310 nm. Figure 4 shows experiments using GTP as substrate. Experimental data points showed good agreement with the Michaelis–Menten approximation over a wide range of substrate concen- trations (0.017–1.7 mm). The V max value of Construct C exceeded that of the wild-type protein by a factor of 1.9. Constructs C and E both showed K m values that were increased substantially, by a factor in the range of three- to four-fold, compared with that of the wild- type protein. Notably, the steady-state parameters of the B. subtilis wild-type protein were similar to those of GTP cyclohydrolase II of E. coli that has been stud- ied previously in some detail [11,15]. Steady-state kinetic experiments were also performed with the reaction intermediate 10 (prepared from GTP by enzymatic treatment with a mutated GTP cyclohy- drolase I, as described in Ref. [16]). Experiments were monitored photometrically at 310 nm (Fig. 5). The maximum rate observed with Construct E was again increased by a factor of about 2. Again, the mutated Constructs C and E showed markedly increased K m values (Table 1). It appears likely that the hydrolytic opening of the imidazole ring of GTP has the highest Gibbs free energy barrier of all partial reactions in the GTP cyclohydrolase II trajectory. However, the comparative steady-state analysis using the natural substrate, GTP, and the ring-opened reaction intermediate 10, suggests that the increase in the overall rate constants observed with the mutated proteins is not caused by a lowering of that free energy barrier. Previously, we studied GTP cyclohydrolase II of E. coli using presteady-state kinetic analysis [13]. Unex- pectedly, those experiments had suggested a relatively slow formation of the phosphoguanosyl derivative 7 under release of pyrophosphate. That covalently bound moiety appeared to undergo rapid hydrolytic release of formate from the imidazole ring and ⁄ or hydrolytic cleavage of the phosphodiester bond. It was, in fact, a Fig. 4. Steady-state kinetics of GTP cyclohydrolase II from Bacil- lus subtilis, using GTP as the substrate. Symbols represent the experimental data. Lines represent the Michaelis–Menten approxi- mation (—, wild-type; —, Construct E; ÆÆÆÆ, Construct C). Fig. 5. Steady-state kinetics of GTP cyclohydrolase II from Bacil- lus subtilis using 2-amino-5-formylamino-6-ribosylamino-4(3H)-pyri- midinone 5¢-triphosphate (Compound 10) as the substrate. Symbols represent the experimental data (310 nm). Lines represent the Michaelis–Menten approximation (—, wild-type; - - -, Construct E). Table 1. Kinetic properties of different GTP cyclohydrolase II proteins from Bacillus subtilis. GTP as substrate Compound 10 as substrate k cat (min )1 ) K m (lM) k cat (min )1 ) K m (lM) Wild-type 2.1 ± 0.02 10 ± 1 3.0 ± 0.2 31 ± 7 Construct E 4.3 ± 0.04 44 ± 2 6.0 ± 0.3 122 ± 20 Construct C 3.9 ± 0.04 49 ± 3 5.4 ± 0.1 79 ± 8 Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al. 4122 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS surprising finding that the opening of the imidazole ring was not in any way rate-limiting, despite the relatively high free-energy barrier of that reaction step. We have now conducted similar stopped-flow experi- ments with the wild-type and mutant enzymes of B. subtilis. By comparison with the earlier study, the present experiments were hampered by the tendency of the B. subtilis enzymes to form precipitates after the addition of GTP that were conducive to corruption of the photometric signal by stray light. An in-depth kinetic analysis of the single-turnover data was not possible under these experimental conditions. Never- theless, the data enabled a comparison to be made of the different B. subtilis proteins as well as a comparison with the E. coli protein. Figure 6 shows a single-turnover experiment with wild-type GTP cyclohydrolase II of B. subtilis that was performed using an enzyme ⁄ substrate ratio of 1 : 0.7. The reaction was characterized by a decrease in absor- bance at 252 nm and an apparently synchronous increase in absorbance at 292 nm. The superposition of spectra taken from the series showed an apparent isosbestic point at 278 nm, which suggests an apparent 0.160 0.120 0.080 0.040 0.0 240 260 280 300 320 340 360 380 400 Wavelength (nm) Absorbance 0.1 0.5 1 10 50 Time (s) 5 Fig. 6. Optical spectra from a stopped-flow experiment with wild- type GTP cyclohydrolase II from Bacillus subtilis, using GTP as the substrate. AB CD Fig. 7. Absorbance changes during single-turnover stopped-flow experiments with wild-type GTP cyclohydrolase II (A, B) and Construct E (C, D), using GTP as the substrate. Reaction mixtures contained 50 m M Tris–HCl (pH 8.5), 100 mM NaCl, 10 mM MgCl 2 and 2 mM dithio- threitol. The enzyme solution was mixed with substrate solution at a molar ratio of 1 : 0.7, at a temperature of 35 °C. M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4123 perfect reaction (data not shown). These findings are all similar to the earlier findings made for GTP cyclo- hydrolase II of E. coli [13]. A comparison between the B. subtilis wild-type pro- tein and Construct E can be based on the progression curves at selected wavelengths, as shown in Fig. 7. Figure 7B,D also shows the total differentials of absor- bance obtained at selected wavelengths versus time. The absorbance at 278 nm showed minimal variation for both proteins. The wild-type and mutant proteins showed similar progression curves for the differentials at 310, 295 and 254 nm, suggesting that the two proteins under com- parison perform similarly under single-turnover condi- tions. This unexpected finding will be discussed in more detail below. In similar experiments shown in Fig. 8, the pro- tein ⁄ substrate ratio was varied over a range of 1 : 0.7– 1 : 2.5. Progression curves are shown at 295 nm, a wavelength where the absorption is dominated by the nascent 2,5,6-triaminopyrimidinone motif present in the hypothetical covalent intermediate 9 and the product 10, with only a minor contribution (by the substrate, GTP 1) to the absorbance. Differentials of the absorbance at 295 nm (dA 295 ⁄ dt) are shown in the frames on the right side of the Figure. Whereas the curves for wild-type and mutant proteins were similar under conditions where there was a slight excess of protein over substrate, the similarity broke down under presteady-state conditions with an excess of AB C D Fig. 8. Numerical simulation of stopped-flow data of wild-type GTP cyclohydrolase II from Bacillus subtilis (A, B) and Construct E (C, D), using GTP as the substrate. The enzyme solution was mixed with substrate solution at molar ratios of 1 : 0.7 (s), 1 : 1.3 ( ) and 1 : 2.5 ( ). Symbols represent the experimental data and lines represent the numerical simulation using the kinetic constants in Table 2. Data sets were analyzed using the program DYNAFIT [24]. Table 2. Single-turnover rate constants of different GTP cyclo- hydrolase II proteins from Bacillus subtilis using GTP as the substrate. Wild type Construct E k2 ⁄ k1 (l M) 4.36 ± 0.18 25.6 ± 0.8 k3 (min )1 ) 13.0 ± 0.11 27.4 ± 0.4 k4 (min )1 ) 3.18 ± 0.02 6.84 ± 0.05 Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al. 4124 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS substrate at the start of the reaction. Under these conditions, we observed a significantly higher initial rate for the mutant protein compared with the wild- type protein. More specifically, dA 295 ⁄ dt at t = 0 was 0.125 for the mutant protein and 0.085 for the wild- type protein. In the case of the wild-type protein, a plateau of dA 295 ⁄ dt at a level of about 0.02, which extended from about 10 to 30 s, followed the initial steep decline. By contrast, the reaction catalyzed by the mutant protein was virtually complete within 30 s. As described in more detail below, this is best explained by the hypothesis that the rate enhancement observed for the mutant under steady-state conditions is caused by differences in the rate of product release. Discussion Four types of GTP cyclohydrolases are known to cata- lyze the hydrolytic cleavage of the bond between C-8 and N-9 of the guanine moiety. The ring-opening reaction can be preceded and ⁄ or followed by other reaction steps catalyzed by the respective enzyme. Specifically, GTP cyclohydrolase I catalyzes the ring opening of GTP, followed by hydrolytic deformyla- tion, Amadori re-arrangement and ring closure resulting in the production of dihydroneopterin triphosphate, which serves as the first committed precursor in the biosynthesis of tetrahydrofolate and tetrahydrobiopterin (for review see Refs. [17]). The recently discovered MptA protein produces the 2¢,3¢- cyclophosphate of dihydroneopterin that is believed to serve as a precursor for the biosynthesis of tetrahydro- methanopterin, a one-carbon transfer cofactor of methanogenic coenzymes [18]. GTP cyclohydrolase II, the subject of this article, is believed to catalyze the release of phosphate from GTP, which is conducive to the formation of a covalent guanylyl adduct that can be resolved by a sequence of ring opening, deformyla- tion and ⁄ or phosphodiester cleavage resulting in the production of 2, the first committed intermediate in the biosynthesis of riboflavin. The covalent adduct remains to be confirmed by direct evidence, but the recently reported 3D structure suggests that Arg128 is the acceptor of the phosphodiester linkage in the E. coli protein [19]. GTP cyclohydrolase III of Archae- bacteria catalyzes ring opening without accessory reactions [20,21]. The resulting 2-amino-5-formylami- no-6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphos- phate is believed to serve as the first committed intermediate in the biosynthesis of riboflavin and of the deazaflavin-type cofactor F420. Divalent cations appear to be essential for all known GTP cyclohydrolases. Specifically, the type I enzyme uses a zinc ion that is coordinated by one cysteine resi- due and two histidine residues. The type II enzyme requires Mg 2+ and a zinc ion that is coordinated by three cysteine residues. It appears plausible that the opening of the imidazole ring involves a relatively large Gibbs free-energy barrier; however, the pre- steady-state analysis of the type I and type II enzymes indicates that the ring opening is not by any means the rate-determining step of the respective reaction trajec- tory; in the case of the E. coli ortholog, which has been studied in some detail, the ring-opening reaction has a rate constant of 0.23 s )1 compared with a rate constant of 0.025 s )1 for the overall reaction. Stopped-flow kinetic studies of wild-type and muta nt GTP cyclohydrolase II of B. subtilis, as described above, were conducted in close analogy to earlier studies on the E. coli enzyme. However, in con- trast to the E. coli enzyme, the B. subtilis proteins had a marked tendency to form precipitates upon mixing with GTP. This behavior suggests that substra te bind- ing is cond ucive to a more hydrophobic and aggrega- tion-prone state of the protein. Owing to the resulting corruption of the optical readout by the stray light contribution, it was not possible to perform a detailed deconvolution of the stopped-flow kinetic da ta, in analogy to the earlier study performed with the E. coli enzy me; despite this shortcoming, the data suggest that the kinetic profile of the B. subtilis enzyme is indeed similar to that of the E. coli enzyme, with the formation of the covalent adduc t as a relatively slow initial step. Even without the opportunity to conduct a compre- hens ive data deconvolution, stopped- flow analysis under single-turnover conditions, as well as prest eady- state conditions, afforded useful information for comp arison of the wild-type protein with the mutant Cons truct E. Specifically, absorbance progression curves of the two pr oteins were similar under strict single-turnover conditions conducted with a molar excess of enzyme over substrate (Figs 7 and 8). By contrast, the kinetic differences became progressively larger when the substrate was proffered in excess ( pre- steady-state conditions with a protein ⁄ substrate ratio up to a value of 1 : 2.5; Fig. 8). Clearly, under these conditions, the mutan t protein generated product at a higher overall rate than did the wild-type protein. Moreover, these observations are perfectly in line with the stea dy-state analysis, indicati ng an approximately two-fold increased k cat of Construct E compared with the wild-type protein. These findings are best explained by the hypothesis that the mutations in Cons truct E affect the rate of product release rather than the ra te of product formation. This hypothesis is M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4125 also well in line with the increased K m values deter- mined for Constructs C and E (Table 1); in fact, preliminary data showed that various mutant protein s selected for their increa sed V max value also showed an increase in their K m value. The increased K m values of the mutant constructs may be caused predominantly by an increased off-rate for dissociation of the Michaelis complex. For the time being, we are limited to speculation because off-rates have not been measured for any of the B. subtilis proteins under study. Speculating further along these lines, it is conceivable that an increased off-rate may apply not only to the enzyme ⁄ substrate complex (Michaelis complex) but also to the enzyme ⁄ product complex. That hypothesis is well in line with the observed reaction acceleration under substrate saturat- ing conditions. An increased off-rate of the Michaelis complex would be irrelevant for the catalytic rate under saturating conditions. There is precedent for enzymes with substrate release as the rate-limiting step for the overall reaction. Never- theless, it came as a surprise that the extensive enzyme-evolution process conducted in this study failed to increase the rate constant significantly for any of the catalytical partial reactions sensus strictiori (resulting in chemical modification of the reactant), although the overall reaction velocity was increased (via accelerated product release, as described earlier). For the practical purpose of improving the produc- tivity of a riboflavin-overproducing strain by intro- ducing the improved GTP cyclohydrolase II domain into a riboflavin-producing strain, it is irrelevant whether the rate acceleration is caused by enhanced substrate conversion or by enhanced product-release rates. The increase in K m accompanying the increase in V max can be tolerated in the technical application because the cellular GTP concentrations are well above the K m , even for Construct E; moreover, this enzyme would be working under substrate-saturating conditions in the in vivo situation. Based on the recently reported X-ray structure of the E. coli enzyme [22], the location of the mutations introduced by the enzyme-evolution strategy in relation to its reaction center can be described at least approxi - mately. In the crystal structure, the location of the cata- lytic site is clearly defined by the position of the zinc and magnesium ions and by bound GMP, one of the products of GTP cyclohydrolase II. As shown in Fig. 9, all mutations in Const ruct E are located outside the first amino acid shell of the substrate ⁄ metal ion-binding cavity. It appears quite plausible that remote mutatio ns can be conducive to subtle deformations of the active- site cavity. This could be conducive to a lowered ligand-binding affinity predominantly caused by an increased off-rate for both substrate and product. An increased off-rate would not be conducive to the premature loss of int ermediates because these are all covalently tethered to the protein. Experimental procedures Materials 2-Amino-5-formylamino-6-ribosylamino-4(3H)-pyrimidinone 5¢-triphosphate (10) was prepared as described previously [16]. Protease inhibitors without EDTA, Taq polymerase, high-fidelity polymerase, restriction enzymes, DNase I, T4 ligase and the nucleotide mixture used for PCR were from Roche Diagnostics (Rotkreuz, Switzerland). Kanamycin sul- fate, ampicillin and most of the other fine-chemicals were supplied by Fluka (Buchs, Switzerland). LB (Luria–Bertani) medium was from Becton Dickinson (Basel, Switzerland). Generation of mutant libraries For the generation of the ribA mutant library, the plasmid pQE60-ribANhis (Table 1) was used in which ribA from B. subtilis was cloned between the EcoR1 and the BamH1 sites of pQE60 (Table 1). The gene itself was slightly modi- fied by the addition of the DNA sequence motif 5¢-GAA TTCattaa agaggagaaattaact ATG AGA GGA TCT CAC CAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢ in front of the start codon. The modified ORF features an Nde1 site at the start codon and specifies a RibA protein carrying an N-terminal 6· His tag. In order to introduce mutations exclusively into the cyclohydrolase II domain of ribA and not into the 3,4-dihydroxy-2-butanone (DHB) synthase domain, error-prone PCR was performed [(using the oligonucleotides ribA3S and ribA4AS (Table 4) as primers] only on the DNA fragment coding for the cyclo- hydrolase II domain. Reaction mixtures for error-prone PCR contained 5 mm MgCl 2 , 0.7 mm MnCl 2 , 0.2 mm Fig. 9. Structure of wild-type GTP cyclohydrolase II from Escheri- chia coli [22]. The positions that are homologous to the mutations in Construct E are marked in yellow. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al. 4126 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS nucleotide triphosphates, 10 ng of template DNA, 2 lm of each primer and 2.5 U of Taq polymerase in 50 lL of the 1· buffer supplied with the polymerase. The reaction condi- tions were as follows: step 1, 3 min, 95 °C; step 2, 30 s, 94 °C; step 3, 30 s, 52 °C; step 4, 45 s, 72 °C; and step 5, 7 min, 72 °C; steps 2 to 4 were repeated 35 times. For reconstruction of the entire ribA gene, the DHB syn- thase domain was also amplified using the oligonucleotides ribA1S and ribA2AS (Table 4) as primers under the follow- ing conditions: 100 ng of template DNA, 2 lm of each pri- mer, 2.5 U high-fidelity polymerase mixture and 0.2 mm nucleotides in 50 lL of the 1· buffer supplied with the poly- merase, using the heating protocol as described above. Both PCR products were purified by agarose-gel electrophoresis and subsequent elution of the desired DNA fragments from the gel. In a third PCR, the purified PCR products were assembled to create the complete ribA gene (100 ng of PCR product 1, 100 ng of PCR product 2, 2.5 U high-fidelity polymerase, 0.2 m m of nucleotides, 2 mm primer ribA1S and 2 mm primer ribA4AS (Table 4) in 50 lL of the buffer supplied with the polymerase; PCR protocol: step 1, 3 min, 95 °C; step 2, 30 s, 94 °C, step 3, 30 s, 52 °C; step 4, 2 min, 72 °C; and step 5, 7 min, 72 °C; steps 2 to 4 were repeated 35 times). The PCR product was purified by using the PCR purification kit from Qiagen. The purified PCR product was digested with EcoRI and BamHI and ligated into pQE60 (Table 3) also digested with EcoRI and BamHI. The ligation product was transformed into the riboflavin auxotrophic strain E. coli RB7 [15] [pREP4] (Table 3). Selection took place on LB plates containing 100 mgÆmL )1 of ampicillin. Transformants were picked into 96-well plates containing 200 lL of LB medium (supplemented with 25 lgÆmL )1 of kanamycin and 100 lgÆmL )1 of ampicillin) and were grown overnight. Dimethylsulfoxide (15 lL per well) was added, and the plates were stored at )80 ° C. For further rounds of mutagenesis, the original ribA gene was replaced with the improved mutants, as selected. Bacterial culture Aliquots (5 lL) from each well of a master plate were trans- ferred into a deep-well plate filled with 250 lL of LB medium (supplemented with 25 lgÆmL )1 of kanamycin and 100 lgÆmL )1 of ampicillin) per well. The plates were incu- bated overnight (37 °C, 250 r.p.m.) on a rotary shaker. The next morning, LB medium (1.2 mL) supplemented with 25 lgÆmL )1 of kanamycin and 100 lgÆmL )1 of ampicillin was added to each well. The plates were incubated at 30 °C on a rotary shaker at 250 r.p.m. After 6 h, isopropyl thio-b- d-galactoside was added to a final concentration of 0.5 mm. The plates were incubated for another 16 h at 30 °C with shaking (250 r.p.m.). At the end of this incubation period, the cells were pelleted by centrifugation (20 min, 3220 g) and stored at )80 °C. Screening Cell pellets in deep-well plates were suspended in 300 lLof 20 mm Tris–HCl (pH 7.5) containing 10 mm MgCl 2 , 15% sucrose, 0.1% Triton X-1000, 0.1 mgÆ mL )1 of lysozyme and 5mgÆmL )1 of DNase I, and the recommended concentra- tion of Roche protease inhibitor without EDTA. The plates were incubated at 20 °C under shaking at 200 r.p.m. for 25 min, followed by centrifugation (20 min, 4000 g). Aliqu- ots (100 lL) of the supernatants were mixed with 150 lLof a reaction mixture containing 100 mm Tris–HCl (pH 8.5), 10 mm MgCl 2 ,15mm mercaptoethanol and 1.6 mm GTP. The absorbance increase at 310 nm was monitored at 37 °C. In parallel experiments, 50-lL aliquots of the supernatants were mixed with 75 lL of a reaction mixture containing 50 mm Tris–HCl (pH 7.5), 10 mm MgCl 2 ,5mm ribose-5- phosphate and 2.7 U of ribose 5-phosphate isomerase in a total volume of 100 lL. The mixtures were incubated for 20 min at 37 °C. A solution (100 lL) containing 2 m NaOH and 35 gÆL a-naphthol was added together with 50 lLof saturated creatine solution. The mixture was incubated at 20 °C for periods of 60 to 120 min, and the absorbance at 525 nm was determined [23]. Protein purification Frozen E. coli cell mass (25 g) was thawed in 60 mL of 50 mm Tris–HCl (pH 8.0), containing 0.3 m sodium chlo- ride and 10 mm magnesium chloride. The cells were Table 3. Microorganisms and plasmids used in this study. Strain or plasmid Genotype or relevant characteristics Reference or source Escherichia coli Rib7 thi leu pro lac ara xyl endA recA hsd r - m - pheS supE44 rib [15] Plasmids pREP4 Low-copy-number plasmid expressing lacI Quiagen Inc. pQE60 Expression plasmid for E. coli Quiagen Inc. pQE60-ribA-Nhis pQE60 with an N-terminally tagged ribA from Bacillus subtilis This study Table 4. Oligonucleotides used in this study. Oligonucleotide Nucleotide sequence (5¢-to3¢) ribA3S TCGCGAAAAAGCATCAATTAAAAATG ribA4AS TAATTAAGCTTGGATCCTTAG; ribA1S TAACAATTTCACACAGAATTC ribA2AS GATGCTTTTTCGCGATTTCAATGAGC M. Lehmann et al. Biosynthesis of riboflavin – generation of an improved cyclohydrolase II FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS 4127 disrupted by ultrasonic treatment, and the suspension was centrifuged. The supernatant was applied to a column of Ni-chelating Sepharose FF (GE Healthcare Europe GmbH, Otelfingen, Switzerland; column volume 20 mL), which had been equilibrated with 50 mm Tris–HCl (pH 8.0) containing 0.3 m sodium chloride and 10 mm magnesium chloride (flow rate, 2 mLÆmin )1 ). The column was washed with 100 mL of the equilibration buffer and was then developed with a gradient of 0–200 mm imidazole in 50 mm Tris–HCl (pH 8.0) containing 0.3 m sodium chloride, 10 mm magne- sium chloride and 5% glycerol (total volume, 100 mL). Fractions were combined and dialyzed overnight against 50 mm Tris–HCl (pH 8.5) containing 100 mm sodium chlo- ride, 10 mm magnesium chloride, 2 mm dithiothreitol and 5% glycerol. The enzyme was stored at 4 °C. Steady-state kinetics Reaction mixtures contained 50 mm Tris–HCl (pH 8.5), 100 mm NaCl, 10 mm MgCl 2 ,2mm dithiothreitol and pro- tein in a total volume of 400 lL. Experiments were per- formed at 30 °C. The reaction was initiated by the addition of GTP to a predetermined concentration (0.017–1.7 mm). The assay was monitored photometrically at 310 nm. Reac- tion rates were calculated using an absorption coefficient of 7.43 mm )1 Æcm )1 for 2,5-diamino-6-ribosylamino-4(3H)-pyri- midinone 5¢-phosphate . Stopped-flow kinetic experiments Experiments were performed using an SFM4 ⁄ QS apparatus from Bio-Logic (Claix, France) equipped with a linear array of three mixers and four independent syringes. The content of a 1.5-mm light path quartz cuvette behind the last mixer was monitored using a Tidas diode array spec- trophotometer (200–610 nm) equipped with a 15 W deute- rium lamp as the light source (J&M Analytische Meß- und Regeltechnik, Aalen, Germany). The reaction buffer con- tained 50 mm Tris–HCl (pH 8.5), 100 mm NaCl, 10 mm MgCl 2 and 2 mm dithiothreitol. The enzyme solution was mixed with substrate solution at a temperature of 35 °C and a total flow rate of 4 mLÆs )1 . The calculated dead time was 7.6 ms. Spectra integrated over 96 ms were recorded at intervals of 100 ms. References 1 Stahmann KP, Revuelta JL & Seulberger H (2000) Three biotechnical processes using Ashbya gossypii, Candida famata, or Bacillus subtilis compete with chemical riboflavin production. Appl Microbiol Biotech- nol 53, 509–516. 2 Perkins JB, Pero JG & Sloma A (1991) Riboflavin over- producing bacteria expressing the rib operon of Bacillus. pp. 70. Hoffmann-La Roche, F., und Co. A G., Switzerland. Application: EP. 3 Young DW (1986) The biosynthesis of the vitamins thia- min, riboflavin, and folic acid. Nat Prod Rep 3, 395–419. 4 Bacher A, Eberhardt S & Richter G (1996) In Escheri- chia coli and Salmonella typhimurium (Neidhardt FC, Ingraham JL, Low KB, Magasanik B, Schaechter M & Umbarger HE, eds), pp. 657–664, ASM Press, Washing- ton D.C. 5 Bacher A, Eberhardt S, Eisenreich W, Fischer M, Herz S, Illarionov B, Kis K & Richter G (2001) Biosynthesis of riboflavin. Vitam Horm 61, 1–49. 6 Fischer M & Bacher A (2005) Biosynthesis of flavo- coenzymes. Nat Prod Rep 22, 324–350. 7 Foor F & Brown GM (1975) Purification and properties of guanosine triphosphate cyclohydrolase II from Escherichia coli. J Biol Chem 250, 3545–3551. 8 Kis K, Volk R & Bacher A (1995) Biosynthesis of riboflavin. Studies on the reaction mechanism of 6,7- dimethyl-8-ribityllumazine synthase. Biochemistry (Mosc) 34, 2883–2892. 9 Volk R & Bacher A (1990) Studies on the 4-carbon pre- cursor in the biosynthesis of riboflavin. Purification and properties of L-3,4-dihydroxy-2-butanone-4-phosphate synthase. J Biol Chem 265, 19479–19485. 10 Wacker H, Harvey RA, Winestock CH & Plaut GW (1964) 4-(1¢-d-ribitylamino)-5-amino-2,6-dihydroxypyr- imidine, the second product of the riboflavin synthetase reaction. J Biol Chem 239, 3493–3497. 11 Kaiser J, Schramek N, Eberhardt S, Puttmer S, Schus- ter M & Bacher A (2002) Biosynthesis of vitamin B2. Eur J Biochem 269, 5264–5270. 12 Ritz H, Schramek N, Bracher A, Herz S, Eisenreich W, Richter G & Bacher A (2001) Biosynthesis of riboflavin: studies on the mechanism of GTP cyclohydrolase II. J Biol Chem 276, 22273–22277. 13 Schramek N, Bracher A & Bacher A (2001) Biosynthe- sis of riboflavin. Single turnover kinetic analysis of GTP cyclohydrolase II. J Biol Chem 276, 44157–44162. 14 Hu ¨ mbelin M, Griesser V, Keller T, Schurter W, Haiker M, Hohmann HP, Ritz H, Richter G, Bacher A & Van Loon APGM (1999) GTP cyclohydrolase II and 3,4-di- hydroxy-2-butanone 4-phosphate synthase are rate- limiting enzymes in riboflavin synthesis of an industrial Bacillus subtilis strain used for riboflavin production. J Ind Microbiol Biotechnol 22 , 1–7. 15 Richter G, Ritz H, Katzenmeier G, Volk R, Kohnle A, Lottspeich F, Allendorf D & Bacher A (1993) Biosyn- thesis of riboflavin: cloning, sequencing, mapping, and expression of the gene coding for GTP cyclohydrolase II in Escherichia coli. J Bacteriol 175, 4045–4051. 16 Bracher A, Fischer M, Eisenreich W, Ritz H, Schramek N, Boyle P, Gentili P, Huber R, Nar H, Auerbach G et al. (1999) Histidine 179 mutants of GTP cyclohydro- Biosynthesis of riboflavin – generation of an improved cyclohydrolase II M. Lehmann et al. 4128 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... Montfort WR & Bandarian V (2008) A new use for a familiar fold: the X-ray crystal structure of GTP- bound GTP cyclohydrolase III from Methanocaldococcus jannaschii reveals a two metal ion catalytic mechanism Biochemistry 47, 230–242 22 Ren J, Kotaka M, Lockyer M, Lamb HK, Hawkins AR & Stammers DK (2005) GTP cyclohydrolase II structure and mechanism J Biol Chem 280, 36912– 36919 23 Picollelli MA, Viitanen...M Lehmann et al 17 18 19 20 Biosynthesis of riboflavin – generation of an improved cyclohydrolase II lase I catalyze the formation of 2-amino-5-formylamino-6-ribofuranosylamino-4(3H)-pyrimidinone triphosphate J Biol Chem 274, 16727–16735 Nar H (2004) GTP cyclohydrolase I In Handbook of Metalloproteins (Messerschmidt A, Bode W, Cygler M, eds), Vol... Characterization of an Fe(2+)-dependent archaeal-specific GTP cyclohydrolase, MptA, from Methanocaldococcus jannaschii Biochemistry (Mosc) 46, 6658–6667 Ren J, Kotaka M, Lockyer M, Lamb HK, Hawkins AR & Stammers DK (2005) GTP cyclohydrolase II structure and mechanism J Biol Chem 280, 36912–36919 Graham DE, Xu H & White RH (2002) A member of a new class of GTP cyclohydrolases produces formylaminopyrimidine... structure and mechanism J Biol Chem 280, 36912– 36919 23 Picollelli MA, Viitanen PV & Jordan DB (2000) Spectrophotometric determination of 3, 4-dihydroxy-2butanone-4-phosphate synthase activity Anal Biochem 287, 347–349 24 Kuzmic P (1996) Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase Anal Biochem 237, 260–273 FEBS Journal 276 (2009) 4119–4129 ª 2009 The Authors Journal . Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant Martin Lehmann 1 , Simone Degen 1 , Hans-Peter Hohmann 1 , Markus. mechanism of GTP cyclohydrolase II [13]. mrgshhhhhhgidh Fig. 3. Generation of the cyclohydrolase II mutant library. The DHB synthase and cyclohydrolase II