a new measurement scale for employee engagement
... was modeled as unidimensional (Kahn, 1992; May et al., 2004). Scale Development Scale development was undertaken to create itemsto measure engagement as a unidimensional experientialstate that ... the new scale, and data collection and analysisfrom a replication sample. PHASE 1: CONSTRUCT DEFINITION AND VALIDATION Although Kahn’s(1990)seminal work explored “discrete moments” of...
Ngày tải lên: 07/09/2013, 11:05
... of nucleoli appearance and disappearance. Nucleoli are not distinguishable before simple follicle formation in Octopoteuthis sicula, Sepia bertheloti and Abraliopsis atlantica. In Argonauta argo and Pteriqioteutnis gemmata, at ... male cephalopods, stages IV and Vare short and perhaps of little ecological importance since they have to accumulate a large quantity of spermatophores in the Nee...
Ngày tải lên: 14/03/2014, 16:20
... satellite image. Therefore, the actual accuracies could be better than shown here since the accuracy was compared to SCAG land use data. Generally, Bayesian networks gave a reasonable estimate ... pollutant loading area. For the other classes, each water quality parameter exhibited different results. As shown above, COD and TP have only transportation land use as high pollutant loading ar...
Ngày tải lên: 05/09/2013, 09:08
A NEW CAR PLAN FOR A GREENER FUTURE doc
... A NEW CAR PLAN FOR A GREENER FUTURE | 5 4 | A NEW CAR PLAN FOR A GREENER FUTURE | 5 ExECUTIvE SUMMARy A New Car Plan for a Greener Future is the Australian Government’s plan to give our automotive ... is about mutual obligation all round – a genuine partnership. The new car plan acknowledges that all Australians benet from having a healthy automotive indust...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT GCGGCCGCTCAGTCCTGCTC ... the 3¢-UTR, a PCR was performed using Pnr ⁄ BamHI5.4kb as the template with sense primer 5¢-GAAT GCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGC...
Ngày tải lên: 07/03/2014, 21:20
UNISEXUAL SALAMANDERS (GENUS AMBYSTOMA) PRESENT A NEW REPRODUCTIVE MODE FOR EUKARYOTES doc
... 109–134. Bogart, J.P., and Klemens, M.W. 1997. Hybrids and genetic inter- actions of mole salamanders (Ambystoma jeffersonianum and A. laterale) (Amphibia: Caudata) in New York and New Eng- land. Am. ... additional alleles in- corporated from A. laterale or A. jeffersonianum males found in ploidy-elevated tetraploids and among the A. jeffer- sonianum larvae, unisexual individuals have...
Ngày tải lên: 14/03/2014, 16:20
Evolving to a New Dominant Logic for Marketing pdf
... 1988; Parasuraman, Zeithaml, and Berry 1988) •Value and supply chain management (Normann and Ramirez 1993; Srivastava, Shervani, and Fahey 1999) •Resource management (Constantin and Lusch 1994; Day ... Consequences,” in Handbook of Relationship Marketing, Jagdish Sheth and A. Parvatiyar, eds. Thousand Oaks, CA: Sage Publications. ———, Rajendra S. Sisodia, and Arun Sharma (2000), “The Antece...
Ngày tải lên: 15/03/2014, 22:20
Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf
... Dominican Republic, Jamaica, Colombia, Guatemala and Haiti from Latin America and the Caribbean; and Poland from Eastern Europe have significant diaspora presence in the United States. Diaspora ... bilateral migration data in major migration corridors are summarized in Ratha and Shaw (2007). 19 Moroccans in France; and large pools of migrants from India, Pakistan, the Philippines, Bang...
Ngày tải lên: 29/03/2014, 03:20
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... were made: pS3aPG, pS3aPGDa1 ,a2 ,t2 (or pS3aPGDa1), pS3aPGDa3 a5 (or pS3aPGDa3), pS3aPGDa6 ,a7 ,t13 (or pS3aPGDa6), pS3aPGDa8 a1 1,t15 (or pS3aPGDt15), pS3aPGDa12,t17 (or pS3aPGDa12), pS3aPGDa13 a1 5 (or ... Con a1 a9 Con a1 a9 Con a9 a9 LP-Con A B Con - TAATGTC a1 - TAATGAC brG - TGATACG nsA - TGATACA nsT - TGATACT brC - TGATACC LP -a1 Fig. 5. Influence of surrounding...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... H-tunneling by a vibrationally assisted mechan- ism, although a Boltzman analysis suggests a very small population in anything other than the vibrational ground state. An alternative explanation might ... DIFFERENT MEANS Aromatic amine dehydrogenase (AADH), like MADH, is a TTQ-dependent amine oxidase. AADH transfers electrons, derived from the deamination of primary amines (aromatic a...
Ngày tải lên: 31/03/2014, 23:20