Symptomatic treatment of the cough inwhooping cough | Website Bệnh viện nhi đồng 2 - www.benhviennhi.org.vn
Báo cáo y học: "Spatiotemporal regulation of the cough motor pattern" ppsx
... period of expiratory motor quiescence existed between the end of the expiratory motor burst and the onset of the next inspiration during repetitive cough, consistent with the existence of two ... separated the cough cycle into three phases: cough inspiratory (CTI), cough expiratory phase (CTE1), and cough expiratory phase (CTE2) CTI is defined by the duratio...
Ngày tải lên: 13/08/2014, 10:20
Báo cáo "Study of the Treatment of the Liquid Radioactive Waste Nong Son Uranium Ore Processing " pot
... content of the polymer A101 was mg/l 3.4 The flow sheet of the treatment of the liquid radioactive waste Nong Son uranium ore processing The flow sheet of the treatment of the liquid radioactive waste ... ability of the sludge Finally, the authors had proposed the flow sheet of treatment of the liquid radioactive waste N...
Ngày tải lên: 28/03/2014, 15:20
Báo cáo khoa học: "A General Computational Treatment Of The Comparative" doc
... r than John Therefore the semantics of the comparative has to A domain analysis of the regularized structure to obtain an interpretation in the domain An analysis of the scope of the quantitiers ... quantifiers Generally, in the case of the comparative, the criteria used for determining whether or not a quantifier should have a wider scope involves the location...
Ngày tải lên: 31/03/2014, 18:20
Báo cáo khoa học: " Does Intensity Modulated Radiation Therapy (IMRT) prevent additional toxicity of treating the pelvic lymph nodes compared to treatment of the prostate only?" ppt
... proved the advantage of IMRT compared to 3D-CRT in treatment of PO as well as treatment of the WP, it is not possible to estimate the additional risk of IMRT treatment of the pelvic lymphatics compared ... similar risk of rectal, bladder and small bowel toxicity for IMRT treatment of the prostate only and for additional irradiation of the...
Ngày tải lên: 09/08/2014, 09:22
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt
... obtain a contemporary endodontic surgical treatment of the upper first left molar roots This report shows how contemporary removal of a foreign body from the maxillary sinus and treatment of the ... view of the foreign body in the supero medial aspect of the maxillary sinus Intraoperative endoscopic view of the foreign body i...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-c pot
... Chem 27 8, 28 677 28 685 Cui X, Rouhani FN, Hawari F & Levine SJ (20 03) Shedding of the type II IL-1 decoy receptors requires a FEBS Journal 27 2 (20 05) 916– 928 ª 20 05 FEBS 24 25 26 27 28 29 30 31 32 ... found by RT-PCR FEBS Journal 27 2 (20 05) 916– 928 ª 20 05 FEBS T Tanioka et al Regulation of L-RAP ⁄ ERAP2 gene expression Fig Role of the IRF-E and Ets site...
Ngày tải lên: 23/03/2014, 13:20
Đi Tìm Điều Huyền Bí (IN SEARCH OF THE MIRACULOUS) Tập 1 - I OSHO Phần 2 ppsx
... biết biết biến T i ngư i biết biết trở thành Một rishis, nhà tiên tri Upanishad h i, "Ai ngư i biết có đó? Ai ngư i biết? Ai ngư i thấy? Ai ngư i thấy? Ai ngư i kinh nghiệm? Và ngư i kinh nghiệm?" ... n i i u xảy Nhưng i u nghĩa không nhận biết i u xảy Cũng tốt để nhớ việc kinh nghiệm việc diễn đạt sóng đ i nhau, tay tay i u biết n i Khả để biết vô hạn, khả l i gi i hạn i u...
Ngày tải lên: 22/07/2014, 00:21
Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx
... analysis and interpretation and wrote the report AAB contributed to the data analysis and interpretation GS and LT were both responsible for the planning of the work and contributed to data analysis, ... statistical analysis The mean age at diagnosis of the patients was 40 years (range 10–83) and the mean disease duration was 16 years (range 1–42) The mean...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot
... al.: Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type diabetes mellitus: the DiaDDzoB study BMC Psychiatry 20 11 11:141 Submit your next manuscript ... screening tools of depressive symptoms are available for use in patients with DM2, the aim of this study is to investigate the measurement p...
Ngày tải lên: 11/08/2014, 15:22
Forging a regional security community a study of the driving forces behind ASEAN and east asian regionalism 2
... Southeast Asia He argued that ASEAN had become integrated into a nascent security community because of the peaceful norms of the ASEAN Way’ Acharya argued that the social interactions of the ... 20 02 for the inclusion of Australia and New Zealand as core members of an East Asian community with the aim of counter-balancing China’s growing influence i...
Ngày tải lên: 11/09/2015, 10:01
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2
... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt ... caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgatacc...
Ngày tải lên: 14/09/2015, 08:25
Investigation of the role of the ubiquitin proteasome pathway in dengue virus life cycle 2
... on eIF2α by the guanine nucleotide exchange factor eIF2B, thereby inhibiting recycling of the ternary complex that contains the initiator methionine Met-tRNAi (Dever, 20 02; Sonenberg & Hinnebusch, ... validate the function of UBE2A and DDB1 in the DENV life cycle, we tested if silencing of these two genes would also decouple infectious DENV -2 production from RNA repli...
Ngày tải lên: 22/09/2015, 15:18