Lecture 1: Origin of Sociology as a Discipline

A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... Objectives of The Study This research is intended to deal with the followings: - To find out the common strategies of encouraging in Vietnamese as...

Ngày tải lên: 26/11/2013, 13:31

13 1,6K 8
Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... chance To plan a surprise of it, to aim a book at the public favor, is the most hopeless of all endeavors, as it is one of the unworthie...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
Tài liệu Test of English as a Foreign Language doc

Tài liệu Test of English as a Foreign Language doc

... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malays...

Ngày tải lên: 20/02/2014, 11:21

36 870 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...

Ngày tải lên: 07/03/2014, 02:20

10 483 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf

... appeared By comparison with the spectrum of N1-liganded GABARAP (A) , these resonance signals can be attributed to N1-liganded GABARAP By binding to GABARAP, N1 peptide displaces CRT from GABARAP A few ... A dissociation constant of 64 nm for the GABARAP CRT interaction was Calreticulin is a high affinity ligand for GABARAP Fig Homology model of CRT(1–332) with...

Ngày tải lên: 16/03/2014, 05:20

13 560 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... Therefore the redox state of the cysteinyl residues of the various forms of apoFNR – ‘aerobic’ and ‘anaerobic’ apoFNR, and apoFNR obtained by air-induced inactiva...

Ngày tải lên: 23/03/2014, 15:20

10 477 0
Lecture 1: Overview of Java ppt

Lecture 1: Overview of Java ppt

... code through: java HelloWorldApp  Note that the command is java, not javac, and you refer to HelloWorldApp, not HelloWorldApp .java or HelloWorldApp.class Exception in thread "main" java. lang.NoClassDefFoundError: ... http:/ /java. sun.com/docs/books/tutorial/getStarted/index.html  Nuts and bolts of the Java Language http:/ /java. sun.com/docs/books/tutorial /java/ nutsandbolts/i...

Ngày tải lên: 24/03/2014, 03:20

14 340 0
Test  of English  as a  Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Aze...

Ngày tải lên: 25/03/2014, 10:41

28 765 2
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ m...

Ngày tải lên: 30/03/2014, 15:20

17 441 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

... ≥ 65 years, mentally intact and capable of carrying out a conversation and had been residing in the NHs for at least months We defined mentally intact as having a Clinical Dementia Rating (CDR) ... MW, Nygaard HA: Health-related quality of life among old residents of nursing homes in Norway International Journal of Nursing Practice in press Cronbach L...

Ngày tải lên: 18/06/2014, 19:20

9 845 0
Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf

Báo cáo hóa học: " Edge-Functionalization of Pyrene as a Miniature Graphene via Friedel–Crafts Acylation Reaction in Poly(Phosphoric Acid)" pdf

... anticipated Hence, graphite was also treated with TMPBA in the same reaction and work-up conditions For the purpose of having a basic understanding of the starting material, pristine graphite was ... elemental analysis of samples Sample EF FW Table Elemental analysis of graphite and graphite-g-TMPBA Sample Elemental analysis Elemental analysis C (%) H (%) C (%) O (%) As- receiv...

Ngày tải lên: 21/06/2014, 17:20

6 392 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg s theorem ... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns...

Ngày tải lên: 23/06/2014, 00:20

6 268 0
w