EXPRESSION OF RECOMBINANT PROTEIN IN E. coli

... affecting molecular farming of recombinant proteins The expression of foreign proteins was studied in a tobacco system with four major objectives In the first part, a plant-E coli shuttle vector system ... for recombinant proteins Targeting signals retain recombinant proteins within distinct compartments of 28 the cells, preserve integrity and protect them from...

Ngày tải lên: 12/09/2015, 11:08

... derivative of pASV82 (8.2 kb) containing the GUS expression cassette, was constructed by inserting the 3-kb HindIII fragment of pRTL2-GUS (Carrington et al 1991) into the HindIII site of pASV82 ... region The recombinant plasmids described in the Results are indicated in boxes The unique HindIII in pASV82 can be used to clone expression cassettes with the gene of interest...

Ngày tải lên: 16/09/2015, 17:13

... ng of protein per band) with negligible background staining 2.1 Results Expression of recombinant cHSPA6 The result express of recombinant cHSPA6 vector which contain hexahistidine tagged cHSPA6 ... optimum expression of cHSPA6 Lane 1, low molecular weight marker; 2, uninduced in NB; 3, induced in NB; 4, uninduced in LB; 5, induced in LB; 6, uninduced in 2× LB; 7, indu...

Ngày tải lên: 24/10/2016, 14:24

... 2PV eht gniniatnoc rotcev gninolc OPOT ehT iloc E ocE lgB rotcev noisserpxe 2PV fo noitcurtsnoC rerutcafunam eht yb dednemmocer sdohtem eht gniwollof )ASU ,negortivnI( rotcev gninolc OPOT eht ni ... deifirup htiw dezinummi snekcihc fo ytilibani ehT ni 2PV fo noisserpxe eht gnirud gnidlof reporpmi ot eud sepotipe lanoitamrofnoc ton tub raenil tsniaga detcerid saw nietorp 2PV htiw dezinummi sne...

Ngày tải lên: 07/08/2014, 18:21

... with RTBp24, triggered levels of < /b> anti -p24 < /b> antibodies comparable to < /b> those obtained by immunization with p24 < /b> alone in the presence of < /b> cholera toxin < /b> Our results demonstrate that ricin < /b> toxin < /b> B subunit ... has been usually fused < /b> to < /b> the N-terminal domain of < /b> RTB to < /b> avoid steric hindrance by the antigen with RT...

Ngày tải lên: 12/08/2014, 04:21

... reported that 5% of the cases of oral squamous cell carcinoma show diminished expression of hMSH2 protein In the present study, we demonstrated decreased expression of hMSH2 protein in reticular ... OLP subtypes Figure Positive labelling for hMSH2 protein in basal and intermediate epithelial layers of reticular subtype of oral lichen planus patient (str...

Ngày tải lên: 03/11/2012, 09:54

... The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration Verification of J-chain expression To examine production of J-chain, transfected ... density was analysed by TOTALLAB gel software (Phonetix, UK) The amount of SC present in each supernatant was calculated relative to a standard preparation with known con...

Ngày tải lên: 18/03/2014, 01:20

... amplification of the corresponding part of HMGN2 cDNA) In A549 cells, replenishment of HMGN2 protein upregulated the protein levels of HBD-2, an indication that the levels of this protein are indeed linked ... Based on these data, we propose that HMGN2 and p65 mutually reinforce their specific binding to the chromatin in the promoter of the HMGN2 gen...

Ngày tải lên: 22/03/2014, 16:20

... determined by comparing the level of COX protein in the sum of the two mitochondria populations with that in the homogenate, was 88% Expression of UCP3 protein in SS and IMF mitochondria of various ... and soleus muscles Hesselink et al [23], who studied the distribution of UCP3 protein in various human muscle types by immunofluorescence, showed a higher...

Ngày tải lên: 24/03/2014, 04:21

... construct Preferential localization of the fluorescence was observed in the region of the emerging root hairs (ERH), both in a hair in the bulge stage (B) and in a growing root hair in the phase of organelle ... protein in the ER and which one represents a more specific targeting In root hairs expressing the GFP-ER fusion, the tip localizat...

Ngày tải lên: 31/03/2014, 07:20

... 2002 Fig Degradation of IGFBP-4 and IGFBP-5 by murine PAPP -A and PAPP-Ai as a function of time Recombinant murine PAPP -A (s and PAPP-Ai (d) (both at 0.1 nM) were incubated with radiolabeled IGFBP-4 ... PAPP -A or PAPP-Ai functions in a given system Importantly, the availability of an expression system for recombinant murine PAPP -A will allow generation ant...

Ngày tải lên: 31/03/2014, 21:21

... to explain the large variability observed in the levels of recombinant protein yield Recent studies on the transcriptomic profiling of recombinant cultures has improved our understanding on the ... in molecular biology 267:155–167 doi:10.1186/2191-0855-1-33 Cite this article as: Sharma et al.: Comparative transcriptomic profile analysis of fed-batch cultures exp...

Ngày tải lên: 20/06/2014, 23:20

... Effect of pyrogen induced fever on the pharmacokinetics of cefazolin in goats Indian J Pharmacol 1992 24,51 15 Saini SPS Effect of fever on pharmacokinetics and dosage regimen of amikacin in cow ... the pharmacokinetics and dosage of cefuroxime by endotoxin -induced fever in buffalo calves Vet Res Commun 1999, 23, 361-368 Dardi MS, Sharma SK, Srivast...

Ngày tải lên: 07/08/2014, 18:21

... TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA The DKK1b primer pair was used for standard PCR amplification of ... HTLV-I antisense transcripts initiate in the 3’LTR and are alternatively spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguch...

Ngày tải lên: 13/08/2014, 01:20