Báo cáo khoa học: The chromosomal protein HMGN2 mediates lipopolysaccharide-induced expression of b-defensins in A549 cells potx

The chromosomal protein HMGN2 mediates lipopolysaccharide-induced expression of b-defensins in A549 cells Lu-Xia Deng1,2, Gui-Xia Wu1, Yue Cao1, Bo Fan1, Xiang Gao1, Lin Luo3 and Ning Huang1,4 Research Unit of Infection and Immunity, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, China Chongqing Lummy Pharmaceutical Co Ltd, Chongqing, China Department of Anesthesiology, West China College of Stomatology, Sichuan University, Chengdu, China State Key Laboratory of Biotherapy, West China Hospital, Sichuan, Chengdu, China Keywords high mobility group protein N2; human b-defensin-2; lipopolysaccharide; p65; regulation Correspondence N Huang, Research Unit of Infection and Immunity, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, China Fax ⁄ Tel: +86 28 8506 8208 E-mail: huangpanxiao@126.com (Received 13 August 2010, revised April 2011, accepted 11 April 2011) Human b-defensin-2 (HBD-2) is an antimicrobial peptide produced by the epithelial cells that plays an important role in innate and adaptive immunity Here we report that high mobility group protein N2 (HMGN2), a member of the high mobility group superfamily that affects chromatin function, modulates the expression of HBD-2 in A549 cells treated by lipopolysaccharide Mechanistically, HMGN2 prolongs the retention time and enhances the accumulation of nuclear factor jB p65 in the nucleus, and promotes the acetylation of p65 through increasing histone acetyltransferase activity and enhancing p65-Ser536 phosphorylation Additionally, chromatin immunoprecipitation reveals that HMGN2 and p65 synergistically promote their specific binding to HBD-2 promoter, thereby affecting the downstream transcription Taken together, these results suggest that HMGN2 acts as a positive modulator of nuclear factor jB signalling to promote lipopolysaccharide-induced b-defensin expression doi:10.1111/j.1742-4658.2011.08132.x Introduction Antimicrobial peptides are produced by many different tissues of the body when the innate immune system is activated by lipopolysaccharide (LPS) or other inflammatory cytokines and chemokines Defensins are small cationic antimicrobial peptides which have usually been categorized into three major families based on the molecular structure: a-, b-, and h-defensins [1–3] They regulate both the innate and adaptive immune responses, exhibiting broad-spectrum antimicrobial activity against most Gram-positive and Gram-negative bacteria, fungi and viruses such as influenza viruses b-defensins are largely expressed in epithelial cells on the surface of respiratory, gastrointestinal and genitourinary tracts and skin [3,4] Human b-defensin (HBD) is constitutively expressed in the epithelial surface of the respiratory and genitourinary tracts [5] In contrast, the expression of HBD-2, HBD-3 and HBD-4 is inducible in response to LPS, tumour necrosis factor a (TNF-a), interleukin 1b or Gram-negative pathogens, underscoring their crucial role in epithelial host defence under inflammatory conditions [4,6] Inducible expression of b-defensins by human epithelial Abbreviations AA, anacardic acid; ChIP, chromatin immunoprecipitation; Co-IP, co-immunoprecipitation; Glut2, type glucose transporters; HAT, histone acetyltransferase; HBD, human b-defensin; HDAC, histone deacetylase; HMG, high mobility group; HMGA, HMG-AT-hook family; HMGB, HMG-box family; HMGN2, high mobility group protein N2; IjBa, NF-jB inhibitor a; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NF-jB, nuclear factor jB; PE-H, pEGFPN1-HMGN2; Psi-H, pSilencer-HMGN2-2; siRNA2, small interfering RNA2; TNF-a, tumour necrosis factor a; TSA, trichostatin 2152 FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al HMGN2 mediates expression of b-defensins cells has been shown to be regulated through several signalling pathways, such as the nuclear factor jB (NF-jB) pathway, the p38 mitogen-activated protein kinase (MAPK) pathway, the c-Jun N-terminal kinase pathway and the phosphatidylinositol-3-kinase ⁄ AKT pathway [7–11] The chromatin-associated high mobility group (HMG) superfamily includes the HMG-AT-hook (HMGA) family, HMG-box (HMGB) family and HMG nucleosome binding (HMGN) family and modulates a wide range of DNA-dependent activities such as chromatin structure, post-translational modifications, and rates of transcription, replication and recombination [12–15] Interestingly, recent studies have demonstrated that some members of the HMG family such as HMGA1 and HMGB1 are directly involved in the regulation of NF-jB activation and its downstream gene transcription [3,16–18] It is well known that NF-jB activation is regulated by RelA ⁄ p65 acetylation and deacetylation which are mediated by histone acetyltransferases (HATs) and deacetylases (HDACs), respectively [19,20] HAT-mediated acetylation of RelA ⁄ p65, particularly at lysine 310 and to a lesser extent at lysine 221, enhances NF-jB ⁄ DNA binding and attenuates its interaction with NF-jB inhibitor a (IjBa) [21] Conversely, acetylated RelA ⁄ p65 is deacetylated by HDACs, leading to the repression of downstream gene transcription and IjBa-dependent nuclear export of IjBa ⁄ NF-jB complex [20,22] The NF-jB activity and the expression of its downstream gene alter when HAT and HDAC inhibitors respectively are used [23–26] HMGN2 has been shown to partially decrease HDAC activity [27] and also to enhance the H3K14ac level in chromatin by stimulating HAT activity [13] Nevertheless, it is unclear whether HMGN2 modulates NF-jB activity by changing the activity of HATs and ⁄ or HDACs and thereby regulates the expression of downstream target HBD-2 Therefore, in the present study we initially supposed that (a) HMGN2 elevates the activity of NF-jB, enhances the amount of NF-jB p65 in the nucleus and regulates the equilibrium between HATs and HDACs thereby affecting p65 acetylation; and (b) HMGN2 itself or through interaction with p65 binds to the chromatin in the promoter region of b-defensin genes to enhance HBD-2 expression This research aimed to confirm the initial hypothesis through transient transfection and luciferase experiments, the activity of HAT and HDAC blocking experiments, chromatin immunoprecipitation (ChIP) assay and co-immunoprecipitation (Co-IP) etc Results Gene expression profiles after HMGN2 knockdown or ⁄ and LPS stimulation in A549 cells As the first step to characterizing the function of HMGN2 in transcriptional regulation in response to LPS, we prepared knockdown HMGN2 in A549 cells and found that HMGN2 expression at both mRNA and protein levels was significantly downregulated in A549 cells treated by HMGN2-specific small interfering RNA2 (SiRNA-HMGN2-2) (Figs 1A,B and S1) Next we employed a cDNA microarray to examine the effect of reduced endogenous HMGN2 level and ⁄ or LPS treatment on gene expression profiles in A549 cells (Figs S2 and S3) The results showed that HMGN2 downregulation altered the expression of over 4% of 31 000 genes by twofold or more (Table 1) A B -actin HMGN2 FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 1.0 RT-PCR * Western blot 0.8 0.6 0.4 * E H/P Psi- Ps E-H H/P i 0.2 Psi- D -H Ps i-H Ps i-H /PE Ps i-H /PE -H Ps i nk bla PE HMGN2 Histone H3 N Psi Ps i-H bla nk Ma ke r Ps i-H Psi /PE -H Ps i-H /PE PE - H PE -actin HMGN2 B bla nk PE PEH HMGN2 RT-PCR western blot -H C N M HMGN2/ -actin ratio(RT-PCR) HMGN2/histone H3 western blot B PE Fig Efficient knockdown of HMGN2 in A549 cells Representative RT-PCR (A) or western blot (B) results showing that HMGN2 mRNA and protein levels were reduced by over 80% after siRNA2 treatment b-actin and histone H3 served as the loading control for RT-PCR and western blot, respectively B, blank group; N, normal group (without LPS treatment); M, marker 1–3, different HMGN2 siRNA (C) Representative RT-PCR and western blot results showing the expression of HMGN2 mRNA and protein in the different established stable A549 cells (D) Values are presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group HMGN2 Histone 2153 HMGN2 mediates expression of b-defensins L.-X Deng et al Table List of genes with changed expression in microarray analysis Log ratio GenBank CGAP gene symbol NM_007315.2 NM_139276.2 STAT1 STAT3 NM_000572.2 NM_000584.2 NM_000600.1 NM_004513.3 NM_000576.2 NM_001315.1 NM_002969.3 NM_002746.1 NM_002749.2 NM_002751.5 NM_002751.5 NM_018661.2 NM_001556.1 IL10 IL8 IL6 IL16 IL-1b MAPK14 MAPK13 MAPK3 MAPK7 MAPK11 DEFB4 (HBD-2) DEFB103A(HBD-3) IKBKB NM_002468.2 NM_021975.2 MYD88 RELA NM_000346.2 BVA CVA DVA 3.5 5.3 )2.0 )2.4 1.7 2.1 4.1 3.9 4.9 2.9 4.6 3.7 3.4 2.8 3.0 2.1 5.3 4.2 )4.1 )2.3 )2.0 1.9 0.3 )3.7 1.2 )2.1 )1.4 )3.7 )0.1 )3.4 )3.2 3.1 1.5 2.8 6.3 3.4 1.3 5.8 1.2 1.2 )0.3 2.9 2.7 1.8 )1.9 3.4 5.8 1.1 )3.1 4.9 1.2 SOX9 )0.2 )4.2 )4.1 NM_000591.1 NM_002228.3 NM_001569.2 NM_002751.5 NM_014261.1 NM_003266.2 NM_014294.3 NM_005252.2 NM_003225.2 CD14 JUN IRAK1 TRAF6 TRIF TLR4 TRAM1 FOS TFF1 5.3 4.8 4.0 )3.2 2.8 4.9 1.1 3.2 1.2 )1.0 )2.9 )1.4 2.9 )1.4 )2.2 1.4 1.9 3.2 4.1 2.2 2.3 )1.3 1.9 3.6 2.6 5.7 4.8 NM_005080.2 BU739862 XBP1 MED19 3.0 )0.9 1.3 )0.5 4.9 )1.1 NM_003187.3 TAF9 )0.5 )1.1 )1.2 BU739862 LCMR1 0.6 1.6 2.8 BX537584 NM_000125.1 NM_001904.2 NM_001792.2 NM_003508.1 NM_012193.2 NM_004625.3 NM_003392.3 NM_002335.1 NM_002336.1 NM_153426.1 NM_022454.2 NM_052942.2 NM_002093.2 PC4 ESR1 CTNNB1 CDH2 FZD9 FZD4 WNT7A WNT5A LRP5 LRP6 PITX2 SOX17 GBP5 GSK3B 3.8 0.5 4.8 4.2 2.8 3.14 2.5 3.3 1.4 1.4 0.4 3.5 0.5 )0.6 3.9 )3.1 3.4 2.6 1.7 2.1 1.3 1.9 1.9 2.3 4.1 )2.4 1.8 2.9 7.0 )2.7 7.2 7.7 5.1 5.1 5.5 4.7 4.2 3.4 4.5 1.8 1.5 1.9 2154 Entrez gene description Signal transducer and activator of transcription 1, 91 kDa Signal transducer and activator of transcription (acute-phase response factor) Interleukin 10 Interleukin Interleukin (interferon, beta 2) Interleukin 16 (lymphocyte chemoattractant factor) Interleukin 1, beta Mitogen-activated protein kinase 14 Mitogen-activated protein kinase 13 Mitogen-activated protein kinase Mitogen-activated protein kinase Mitogen-activated protein kinase 11 Defensin, beta Defensin, beta 103A Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta Myeloid differentiation primary response gene (88) v-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3, p65 SRY (sex determining region Y) box (campomelic dysplasia, autosomal sex-reversal) CD14 antigen v-jun sarcoma virus 17 oncogene homolog (avian) Interleukin-1 receptor-associated kinase TNF receptor-associated factor TIR domain containing adaptor inducing interferon-beta Toll-like receptor Translocation associated membrane protein v-fos FBJ murine osteosarcoma viral oncogene homolog Trefoil factor (breast cancer, estrogen-inducible sequence expressed in) X-box binding protein Mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) TAF9 RNA polymerase II, TATA box binding protein (TBP) associated factor, 32kDa Mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) Activated RNA polymerase II transcription cofactor Estrogen receptor Catenin (cadherin-associated protein), beta 1, 88kDa Cadherin 2, type 1, N-cadherin (neuronal) Frizzled homolog (Drosophila) Frizzled homolog (Drosophila) Wingless-type MMTV integration site family, member 7A Wingless-type MMTV integration site family, member 5A Low density lipoprotein receptor-related protein Low density lipoprotein receptor-related protein Paired-like homeodomain transcription factor SRY (sex determining region Y) box 17 Guanylate binding protein Glycogen synthase kinase beta FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al HMGN2 mediates expression of b-defensins Table (Continued) Log ratio GenBank CGAP gene symbol NM_001791.2 BX640852 NM_003387.3 NM_004333.2 NM_002755.2 NM_002745.2 NM_000539.2 BVA CVA DVA Entrez gene description CDC42 WASL WASPIP BRAF MAP2K1 MAPK1 RHO 4.0 3.7 0.1 3.8 3.6 3.4 4.3 2.5 )2.2 )1.8 )2.3 )1.8 )1.0 1.2 7.1 1.1 )1.1 2.6 2.2 4.6 6.1 NM_005406.1 NM_018890.2 ROCK1 RAC1 0.6 3.1 )2.4 1.6 )2.5 3.7 BQ051103 BM907805 BQ940876 HMGN2 H3F3A HIST1H1C )0.3 3.1 )0.3 )8.5 )2.1 )2.1 )7.9 1.8 )2.4 Cell division cycle 42 (GTP binding protein, 25kda) Wiskott–Aldrich syndrome-like Wiskott–Aldrich syndrome protein interacting protein v-raf murine sarcoma viral oncogene homolog B1 Mitogen-activated protein kinase kinase Mitogen-activated protein kinase Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) Rho-associated, coiled-coil containing protein kinase Ras-related C3 botulinum toxin substrate (rho family, small GTP binding protein Rac1) High mobility group nucleosomal binding domain H3 histone, family 3A Histone 1, H1c Among these genes, only about 2% were upregulated, while the rest were downregulated All these genes have been annotated in the NCBI Reference Sequence database In contrast, LPS stimulation obviously activated several signalling pathways including the NF-jB pathway to induce the expression of cytokines and antimicrobial peptides About 5% of genes were upregulated and 3% were downregulated in group C compared with group A In addition, 4% of genes were upregulated and 2% were downregulated in group D compared with group A (Table 1) Significantly, the expression of DEFB4 (HBD-2) and DEFB103A (HBD-3) was changed and the ratios of log were increased after LPS induction and decreased after HMGN2 knockdown The microarray analysis of the human genome chip containing 31 000 genes revealed differential expression of 3–5% in the four groups (with a false discovery rate corrected P £ 0.05 and fold change ‡ 1) The changed gene expression profiles could be categorized into following gene ontology: MAPK, focal adhesion, Toll-like receptor, epithelial cell, regulation of actin cytoskeleton, vascular endothelial growth factor, Fc epsilon, Wnt, cytokine–cytokine receptor interaction, apoptosis, adherens junction, dorso-ventral axis formation, T cell receptor, insulin and JAK–STAT signalling pathways HMGN2 regulates LPS-induced HBD-2 expression in A549 cells Since microarray analysis showed that the expression of HBD-2 was significantly changed after LPS induction and HMGN2 knockdown, next we aimed to confirm these results by RT-PCR and western blot We employed a variety of A549 cells with stable transfections of pSilencer-HMGN2-2 (Psi-H), pEGFPN1- HMGN2 (PE-H), control siRNA (Psi, PE), wild-type A549 cells (blank), and reintroduction of HMGN2 expression vector or control vector to HMGN2 knockdown A549 cells (Psi-H ⁄ PE-H or Psi-H ⁄ PE, respectively; Figs 1C,D, S4 and S5) These cells were treated with 0, 20, 40, 60, 80 or 100 lgỈmL)1 LPS for 24 h and then the RNA and protein were isolated for RTPCR and western blot analysis The results demonstrated that LPS induced HBD-2 expression in a dosedependent manner which can be abolished by HMGN2 knockdown However, reintroduction of HMGN2 into HMGN2 knockdown cells recovered LPS-induced expression of HBD-2 (Fig 2A–D) Taken together, these data suggest that HMGN2 is crucial for LPS-induced HBD-2 expression To verify that the decreased levels of HBD-2 protein and transcripts are indeed linked to the expression levels of HMGN2, the plasmid expressing double-point mutant HMGN2-S24, 28E was prepared (this protein enters the nucleus but does not bind to chromatin); then we examined the levels of HBD-2 expression level in HMGN2) A549 cells that were stably transformed with plasmid expressing either the wild-type HMGN2 protein (PEGFPN1-HMGN2) or the double-point S24, 28E HMGN2 protein (PEGFPN1-HMGN2-S24, 28E deletion mutants were generated by PCR amplification of the corresponding part of HMGN2 cDNA) In A549 cells, replenishment of HMGN2 protein upregulated the protein levels of HBD-2, an indication that the levels of this protein are indeed linked to the cellular levels of HMGN2 In contrast, replenishment of the S24, 28E HMGN2 double-point mutant, which does not bind to chromatin, did not change the levels of HBD-2, suggesting that the interaction of HMGN2 with chromatin regulates HBD-2 expression signifi- FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2155 HMGN2 mediates expression of b-defensins B PE-H group PE group β-actin HBD2 B group β-actin HBD2 Psi-H group β-actin HBD2 Psi group β-actin HBD2 Psi-H/PE-H group Psi-H/PE group HBD-2 real time PCR PE-H PE group B group Psi-H group Psi group Psi-H/PE-H group * Psi-H/PE group β-actin HBD2 Relative expression of HBD-2 A L.-X Deng et al β-actin HBD2 β-actin HBD2 * * * * * * * 20 40 60 80 100 LPS stimulated concentration (µg·mL–1) 20 40 60 80 100 LPS stimulated concentration (µg·mL–1) C D PE-H group HBD-2 Western blotting HBD-2 β-actin PE group Psi-H group 1.0 HBD2 β-actin B group 0.8 HBD-2/β-actin ratio HBD2 β-actin PE-H group PE group B group Psi-H group Psi group HBD2 β-actin Psi group HBD2 β-actin Psi-H/PE-H group HBD-2 β-actin Psi-H/PE-H group Psi-H/PE group * 0.6 * * 0.4 0.2 * * * * * * Psi-H/PE group 20 40 60 80 100 HBD-2 β-actin 20 40 60 80 100 LPS stimulated concentration (µg·mL–1) LPS stimulated concentration (µg·mL–1) Cell Transfected HMGN2 HBD-2 β-actin F HMGN2–A549 (PEGFPN1-HM GN2) – + HMGN2–A549 (PEGFPN1-HMG N2-S24,28E) – + Relative expression of HBD-2 E Transfected– 0.8 Transfected+ 0.6 0.4 0.2 HMGN2 HMGN2-S24,28E cantly (Fig 2E) Overall, the results support an important role of HMGN2 with chromatin regulation in inducible HBD-2 expression HMGN2 regulates NF-jB activity in A549 cells To reveal potential mechanisms by which HMGN2 regulates LPS-induced HBD-2 expression, we first examined whether HMGN2 could modulate NF-jB 2156 * Fig HMGN2 is crucial for LPS-induced HBD-2 expression in A549 cells The cells were incubated in DMEM with 10% FBS containing 0, 20, 40, 60, 80 or 100 lgỈmL)1 LPS for 24 h and then HBD-2 mRNA and protein levels were detected by RT-PCR and western blot (A) Representative RT-PCR results showing the expression of HMGN2 mRNA in the different established stable A549 cells b-actin served as the loading control (B) Values of RT-PCR are expressed as relative expression compared with the blank group and presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group (C) Representative western blot results showing the expression of HMGN2 protein in the different established stable A549 cells b-actin served as the loading control (D) Photodensitometric analysis of western blot is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group (E) Western blot analysis of stably transfected HMGN2) A549 cells expressing either HMGN2 or the HMGN2S24, 28E A549 HMGN2) denotes control, non-transformed HMGN2) cells (F) Values of western blots are expressed as relative expression compared with b-actin and presented as mean ± SD for at least five independent experiments performed in triplicate activity in A549 cells because the promoter region of HBD-2 contains four NF-jB binding sites [4] We observed that LPS led to increased NF-jB levels in the nucleus and decreased NF-jB levels in the cytoplasm However, the LPS-induced change of NF-jB distribution was markedly attenuated by HMGN2 knockdown, indicating that loss of HMGN2 inhibits LPS-induced NF-jB accumulation in the nucleus On the other hand, gain of HMGN2 due to overexpression repro- FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al HMGN2 mediates expression of b-defensins A Cytoplasm B Nucleus C Cytoplasm NF-κB Western blotting PE B Psi-H Psi Psi-H/ PE-H 0.8 0.6 NF-κB p65 nuleus preotein/whole protein ratio 0.8 * 0 Psi-H/ PE 20 40 60 80 100 LPS stimulated concentrations (µg·mL–1) * * * * 0.2 Psi-H/ PE-H * Psi-H/PE group * Psi * * * 0.2 0.6 0.4 Psi-H * * E NF-κB western blotting PE-H group PE group B group Psi-H group Psi group Psi-H/PE-H group * 1.0 B 0.4 LPS stimulated concentrations (µg·mL–1) D PE * * * * A fold induction (compared to mock infection) 20 40 60 80 100 20 40 60 80 100 Psi-H/ PE PE-H group PE group B group Psi-H group Psi group Psi-H/PE-H group Psi-H/PE group 1.0 Nucleus PE-H 15 30 60 120 180 15 30 60 120 180 NF-κB p65 nulear preotein/total protein ratio PE-H LPS stimulated time (min) PE-H group PE group B group Psi-H group Psi group Psi-H/PE-H group Psi-H/PE group 40 30 * 20 * * 10 0 15 30 60 LPS stimulated time (min) 120 180 PE -H PE B Ps i -H i E H E- H/P sii -H P Ps Ps /P Fig HMGN2 regulates NF-jB activity in A549 cells (A–D) HMGN2 promotes the nuclear accumulation of p65 At 24 h after transfection, the cells were incubated in DMEM with 10% FBS containing 0, 20, 40, 60, 80 and 100 lgỈmL)1 LPS Fresh medium was added h later (A) Representative western blot results showing the cytoplasmic and nuclear distribution of p65 in the different established stable A549 cells (B) Photodensitometric analysis of western blot is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group The cells were incubated in DMEM with 10% FBS containing 100 lgỈmL)1 LPS Fresh medium was replaced 0, 5, 15, 30, 60, 120, 180 later (C) Representative western blot results showing the cytoplasmic and nuclear distribution of p65 in the different established stable A549 cells (D) Photodensitometric analysis of western blot is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group (E) HMGN2 promotes the transcription activity of NF-jB The cells were transfected with NF-jB luciferase reporter and treated by LPS The luciferase activity is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group The luciferase activity in the blank group untreated by LPS (mock) was utilized as the control value ducibly prompted the accumulation of NF-jB in the nucleus (Fig 3A–D) To further confirm that HMGN2 modulates LPSinduced NF-jB activation in A549 cells, A549 cell lines harbouring a transient NF-jB-dependent luciferase reporter were utilized Following LPS (100 lgỈmL)1) treatment for h, a 20- to 25-fold increase in luciferase activity from the baseline level was seen in normal A549 cells (Fig 3E) Compared with normal A549 cells (group B), luciferase activity was increased 25% in HMGN2 overexpressing cells (PE-H) and decreased 50% in HMGN2 knockdown cells (Psi-H) Significantly, restoration of HMGN2 expression in HMGN2 knockdown cells increased luciferase activity to a level comparable with normal A549 cells (Psi-H ⁄ PE-H) (Fig 3E) Taken together, these data prove that HMGN2 regulates LPS-induced NF-jB activity in A549 cells FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2157 HMGN2 mediates expression of b-defensins L.-X Deng et al (Table 2) that the acetylation of p65-Lys310 was decreased in HMGN2 knockdown cells with 100 lgỈmL)1 LPS for 5, 15, 30, 60 or 120 and increased in HMGN2 overexpressing cells with 100 lgỈmL)1 LPS for 60 and 120 but the later difference was not statistically significant (Fig 4A,B), suggesting that HMGN2 promotes the acetylation of p65-Lys310 mainly by enhancing HAT activity Since p65-Lys310 acetylation depends on p65-Ser536 phosphorylation, we also examined the effect of HMGN2 on p65-Ser536 phosphorylation and found that HMGN2 could enhance the phosphorylation of p65 on Ser536 as well Furthermore, western blot analysis demonstrated that the phosphorylation of p65 on Ser536 was upregulated in the PE-H group and downregulated in the Psi-H group compared with the blank group However, inhibition of HDAC or HAT did not affect p65 phosphorylation (Fig 4C,D) These results demonstrated that HMGN2 promoted p65-Lys310 acetylation via enhancing p65-Ser536 phosphorylation and increasing HAT activity Table Cell grouping in HAT and HDAC activity experiments Groups Descriptions PE-H group A549 cells stably transfected with PEGFPN1-HMGN2 A549 cells stably transfected with PEGFPN1-HMGN2 and then adding AA A549 cells induced by LPS A549 cells stably transfected with pSilencer-HMGN2-2 A549 cells stably transfected with pSilencer-HMGN2-2 and then adding TSA PE-H ⁄ AA group B group Psi-H group Psi-H ⁄ TSA group HMGN2 modulates the acetylation of p65 The transcription factor NF-jB activity is known to be regulated by reversible acetylation through HATs and HDACs Anacardic acid (AA) inhibits HAT activity while trichostatin (TSA) inhibits HDAC activity Therefore, we used these reagents to treat A549 cells Western blot analysis for p65-Lys310 acetylation in AA-treated or TSA-treated cells demonstrated clearly A B Nucleus Psi-H group Psi-H/TSA group B group Psi-H group B group PE-H group PE-H/AA group 15 30 60 120 LPS stimulated time (min) C The acetylation level of p65-Lys310 Psi-H/TSA group a-acetyl-p65 whole cell extract 1.0 PE-H group PE-H/AA group 0.8 * * 0.6 * * 0.4 * 0.2 15 30 60 LPS stimulated time (min) PE-H group PE-H/AA group 15 30 60 120 LPS stimulated time (min) 2158 The phosphorylation level of p65-Ser536 B group 120 Psi-H group Psi-H/TSA group a-phosph-p65 whole cell extract Psi-H/TSA * * D Nucleus Psi-H group * * B group PE-H group 1.0 PE-H/AA group 0.8 * * * * 0.6 * 0.4 * * * 0.2 15 30 60 LPS stimulated time (min) 120 Fig HMGN2 increases the HAT activity to promote NF-jB activation The A549 cells were pre-incubated with 25 lM AA for h or 100 nM TSA for 18 h and treated with 100 lgỈmL)1 LPS for 5, 15, 30, 60 or 120 (A) Representative western blot results showing the acetylation of p65Lys310 in the indicated A549 cells (B) Photodensitometric analysis of western blot is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group P < 0.01 PE-H ⁄ AA versus PE-H group (C) Representative western blot results showing the phosphorylation of p65-Ser536 in the indicated A549 cells (D) Photodensitometric analysis of western blot is presented as mean ± SD for at least five independent experiments performed in triplicate *P < 0.01 versus blank group FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al HMGN2 mediates expression of b-defensins The ratio of chromosome immunoprecipitation 8.0 A B M HMGN1/INPUT HMGN2/INPUT HMGN2-/HMGN1/INPUT Fig HMGN2 is enriched in HBD-2 promoter chromatin in A549 cells (A) Enrichment of each DNA sequence in the HMGN2 or HMGN1 immunoprecipitate relative to the input DNA is normalized and plotted as the position of the PCR primer pair within the HBD-2 gene locus Each point is an averaged value from three independent experiments (B) The electrophoretogram chromosome ultrasonication M, maker; 1, the whole chromosome; 2, chromosome analysis following ultrasonication Fold enrichment 6.0 P1 4.0 2.0 0.0 –10 –8 –6 –4 –2 Ex1 1 P1 P1 P1 P1 P1 P1 P1 P1 P1 P P P P P P P P P P G G G G G G G G HMGN2 binds to HBD-2 promoter upon LPS stimulation Members of the HMGN family have been reported to affect the chromatin structure to alter the recruitment of transcription factors to promoter [28] To explore the mechanism by which HMGN2 affects LPS-induced expression of HBD-2, we performed ChIP analysis of the 13 kb region of HBD-2 gene using antibodies to HMGN1 or HMGN2 and demonstrated a twofold to fourfold enrichment of HMGN2 over a )3 kb region 5¢ to the start of transcription, suggesting that the region for P1 amplification contains the enrichment region for HMGN2 and HBD-2 chromatins (Fig 5) More importantly, in the HBD-2 chromatin derived from the HMGN2) A549 cells, the level of HMGN1 was enriched in several regions, especially those spanning primer sets P13–P6 and P5–P2 (Fig 5) The increased level of HMGN1 in the HBD-2 chromatin of the HMGN2) A549 cells suggested that HMGN1 and HMGN2 had functional redundancy among them Furthermore, to address the possibility that HMGN2 promotes the interaction of NF-jB p65 with HBD-2 promoter, we produced knockdown HMGN2 and performed ChIP analysis to show that depletion of HMGN2 affected the chromatin binding of NF-jB (Figs 6A and S6), indicating that HMGN2 enhances the interaction between p65 and HBD-2 promoter Thus we hypothesized that HMGN2 and p65 may preassemble into a regulatory complex on HBD-2 promoter However, Co-IP experiments demonstrated that p65 and HMGN2 did not assemble into a complex in the nuclear compartment because HMGN2 antibody efficiently precipitated HMGN2 from nuclear extracts of A549 cells but the precipitates did not contain p65 (Fig 6B) Likewise, anti-p65 immunoprecipitated p65 efficiently and the precipitates did not contain HMGN2 (Fig 6B) Next, we examined whether HMGN2 and p65 share the same binding sites on HBD-2 promoter ChIP analysis indicated that the antibodies to HMGN2 and p65 efficiently immunoprecipitated chromatin containing the respective proteins (Fig 6C), but the chromatin with HMGN2 enrichment does not contain p65 (Fig 6C, upper left panel) and the chromatin with p65 enrichment does not contain HMGN2 (Fig 6C, lower right panel) Based on these results we conclude that HMGN2 could not interact with p65 in nuclear extracts and they did not share the same chromatin binding site In contrast, results of reciprocal sequential ChIP analysis revealed that chromatin that was sequentially immunoprecipitated with HMGN2 and p65 antibody was enriched in the DNA of HBD-2 promoter (P1) while the HBD-2 promoter was enriched in chromatin that was sequentially immunoprecipitated with antip65 and anti-HMGN2 (Fig 6D,E), suggesting that HMGN2 and p65 mutually promote their binding to the promoter of HBD-2 Discussion The mechanism underlying the regulation of the expression of antimicrobial peptides including b-defensins has not been elaborated at the transcriptional level Our studies indicate that chromatin binding protein HMGN2 mediates the LPS-induced expression of FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2159 HMGN2 mediates expression of b-defensins HBD-2 P1 1.0 Input Control IgG α-p65 + α-HMGN2 – 0.5 – + + – – + a-HMGN2 B a-NF-κB p65 C gG WB: IP: IP: 65 α-P ut ol l inp ntr Co 10% lgG IP: N2 MG α-H inp Con 10% trol ut IP: No lgG Co ntr ol l gG α-P 65 1% inp ut 5% inp ut : HMGN2– Normal lgG ntr o α-H l lgG MG N2 1% inp ut 5% inp ut IP Psi Psi-H No Fold enrichment at P1 1.5 Co A L.-X Deng et al p65 HMGN2 D 1stChIP Control IgG α-HMGN2 E 1stChIP Control IgG α-p65 Fold enrichment at P1 Input control IgG α-p65 α-HMGN2 + – ro ll gG HM Co GN nt ro ll g αHM G G N2 HBD-2 in A549 cells Our microarray analysis indicated that depletion of HMGN2 protein altered the expression level of over 4% of genes by twofold or more in A549 cells Significantly, the HBD level in the LPS group was fivefold higher than that in the control group, while the HBD-2 level in the HMGN2 knockdown group was threefold less than in the LPS group The results of the microarray are reliable because they agree well with the expression of genes known to be modulated by HMGN2, such as N-cadherin, Sryrelated HMG-box gene (Sox9), pituitary homeobox 2, heat shock proteins and type glucose transporters (Glut2) [4,29–35] Pathway analysis of the microarray results showed that HMGN2 modulates the Toll– NF-jB pathway upon LPS stimulation because the expression of RELA (p65), IKBKB (IjB) and myeloid differentiation primary response gene 88 (MyD88), which were the main members on the Toll–NF-jB pathway, was changed in HMGN2 knockdown plus 2160 – + 1st: α-p65 2nd: α-HMGN2 α- 2nd ChIP nt Co nt ro lI gG α Co -p6 nt ro ll gG αp6 2nd ChIP Co Fold enrichment at P1 HBD-2 P1 + – – + α-HMGN2 α-p65 1st: α-HMGN2 2nd: α-p65 Fig HMGN2 and p65 independently bind HBD-2 promoter in A549 cells (A) Depletion of HMGN2 reduced the binding of p65 to HBD-2 promoter (B) Co-IP assay showing that HMGN2 and p65 did not form a complex in the nucleus IP, antibody used for immunoprecipitation; WB, antibody used for western blot (C) ChIP assay showing that HMGN2 and p65 were not co-localized in the chromatin (D) HMGN2 and p65 were co-localized in the promoter region of HBD-2 chromatin, with the IgG as a negative control (E) ChIP assay showing that HMGN2 or p65 bound to HBD-2 chromatin at P1 LPS groups compared with the LPS group The changes of gene expressions observed in the microarray were identified by RT-PCR and western blotting Finally, the results detected in the microarray were consistent with those achieved through RT-PCR and western blotting, including the change of HBD-2 expression Compared with A549 cells stimulated by LPS, HBD-2 expression was 50% less in HMGN2 knockdown cells and was over 30% higher in HMGN2 overexpressing cells In addition, reintroduction of HMGN2 re-expression led to the recovery of HBD-2 expression by over 70% in HMGN2 knockdown cells Overall, these findings prove that HMGN2 plays an essential role in LPS-induced HBD-2 expression in A549 cells Next we aimed to elucidate the molecular mechanism by which HMGN2 regulates HBD-2 expression HBD-2 promoter contains several binding sites for transcription factors including NF-jB, NF-IL-6 and FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al AP-1 [36–38] Previous studies found that the upregulation of HBD-2 promoter activity was mainly dependent on NF-jB in A549 cells, and LPS is known to induce the activation of NF-jB Therefore, we proposed that HMGN may mediate LPS-induced HBD-2 expression through the NF-jB signalling pathway To examine this possibility we first performed western blot analysis to show that the accumulation of p65 protein in the nucleus, indicative of NF-jB activation, was increased in HMGN2 overexpresssing A549 cells but decreased in HMGN2 knockdown cells Next, we employed NF-jB luciferase reporter assay to quantify NF-jB activation [39] The NF-jB-induced luciferase activity was significantly diminished in HMGN2 knockdown cells and increased in HMGN2 overexpressing cells Based on these data we could conclude that HMGN2 is crucial for LPS-induced NF-jB activation NF-jB activation is known to be reciprocally regulated by RelA ⁄ p65 acetylation and deacetylation mediated by HATs and HDACs HDACs and HATs are enzymes that influence transcription by selectively deacetylating or acetylating the e-amino groups of lysine located near the amino termini of core histone proteins Acetylation of p65 at lysines 218, 221 and 310 by HATs including the general transcriptional coactivators CBP and P300 would impair the association between IjBa and p65, thus enhancing the binding affinity of p65 for DNA [40] The effect of HATs is compromised by HDACs that deacetylate p65 and thus promote the interaction between p65 and IjB HDACs are categorized into two classes: class I HDAC 1, 2, 3, and 11, and class II HDAC 4, 5, 6, 7, and 10 Previous studies reported that the association of NF-jB with HDAC1 and HDAC2 co-repressor proteins functions to repress the expression of NF-jB regulated genes [19,20,22] Interestingly, several studies suggested the relationship between HMGN proteins and the activity of HATs and HDACs An in vitro assay showed that HMGN1 and HMGN2 partially inhibit the endogenous mouse HDAC activity [27] HMGN1 enhances the acetylation level of lysine 14 in the tail of H3, while HMGN1 and HMGN2 increase the acetylation through enhancing the activity of HATs [13] AA is an HAT inhibitor and inhibits the nuclear translocation and acetylation of p65, repressing TNF-induced NF-jB dependent reporter gene expression [25] In contrast, TSA, an HDAC inhibitor, enhances p65 acetylation induced by Gram-negative bacteria and transforming growth factor b1 [41] In addition, HDAC inhibitor SFN led to a time- and dose-dependent upregulation of HBD-2 mRNA and protein expression HMGN2 mediates expression of b-defensins in Caco-2, HT-29 and SW480 cells [42] This is paralleled by changes in the acetylation of distinct core proteins, H4 and HMGN2, resulting in the induction of LL-37, a member of the antimicrobial peptide that protects the urinary tract against invasive bacterial infection [43] In the current study, AA (HAT inhibitor) was selected to test whether blocking HATs diminishes the acetylation level of the p65-Lys310 subunit in the PE-H transfected A549 cells If HMGN2 promotes the acetylation of p65 through increasing HAT activity, AA pretreatment would reduce the acetylation level of p65Lys310 in the nucleus in the PE-H ⁄ AA group compared with the PE-H group On the other hand, TSA (HDAC inhibitor) was used to examine the acetylation level of p65-Lys310 in the Psi-H transfected A549 cells If HMGN2 promotes the acetylation of p65 through inhibiting HDAC activity, the TSA pretreatment would augment the acetylation level of p65-Lys310 in the nucleus in the Psi-H ⁄ TSA group compared with the Psi-H group Because p65-Lys310 acetylation was only allowed when p65-Ser536 was phosphorylated, the p65 global phosphorylation status on Ser536 was also tested by western blotting in five groups The results demonstrated that the amount of p65Lys310 acetylation in the nucleus of A549 cells in the PE-H group was low compared with that in the presence of AA (Fig 4A,B) Adding AA to the HMGN2 overexpressing cells helped to reduce the acetylation level of p65-Lys310 in the nuclei to the normal level, while adding TSA to the HMGN2 knockdown cells did not bring the acetylation level of p65-Lys310 in the nucleus to normal; the difference was not statistically significant Results of western blotting for p65-Lys310 acetylation in AA-treated or TSA-treated cells indicated that HMGN2 increased acetylation of p65Lys310 mainly by enhancing the activity of HATs Since p65-Lys310 acetylation depends on p65-Ser536 phosphorylation, we also examined the effect of HMGN2 on p65-Ser536 phosphorylation Subsequently, thePE-H plus AA group or the Psi-H plus TSA group did not modify p65-Ser536 phosphorylation compared with the PE-H or Psi-H group respectively, the difference not being statistically significant However, western blot analysis demonstrated that the phosphorylation of p65 on Ser536 was upregulated in the PE-H group and downregulated in the Psi-H group compared with the blank group Collectively, these results indicated that HMGN2 promotes p65-Lys310 acetylation mainly via increasing HAT activity and enhancing p65-Ser536 phosphorylation Lastly, we performed ChIP analysis to demonstrate that HMGN2 enhances HBD-2 transcription directly by FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2161 HMGN2 mediates expression of b-defensins L.-X Deng et al binding to the promoter region of this gene HMGN1 also binds to HBD-2 chromatin but not within the enrichment region in A549 cells However, in the HBD2 chromatin derived from the HMGN2) A549 cells, the level of HMGN1 was enriched in several regions, especially those spanning primer sets P13–P6 and P5–P2 Moreover, a previous study had reported that it is likely that homeostatic mechanisms, perhaps involving HMGN2, compensate for the loss of the HMGN1 protein based on structural similarity among them Indeed, the ChIP analyses in that study indicated an increase of HMGN2 in the Sox9 chromatin obtained from HMGN1) ⁄ ) mice, suggesting functional redundancy among these proteins [31] Moreover, the downregulation of HMGN2 decreased the binding of p65 to HBD2 promoter significantly To address the potential relationship between HMGN2 and p65 in the regulation of the HBD-2 promoter region, we did reciprocal sequential precipitation experiments and observed that HMGN2 and p65 specifically target the HBD-2 promoter Co-IP and ChIP experiments demonstrate that HMGN2 does not interact with NF-jB directly and the two proteins not form a complex in the nucleus and or share the same binding sites throughout the entire chromatin These findings are consistent with previous studies reporting the relationship between HMGB1 and glucocorticoid receptor in glucocorticoid receptor binding sites and HMGN3 and PDX1 (a Glut2 transcription factor) In particular, HMGN3 and PDX1 mutually reinforce their specific binding to the Glut2 chromatin without interaction with each other or sharing the same binding sites in Glut2 chromatin [28,44] Based on these data, we propose that HMGN2 and p65 mutually reinforce their specific binding to the chromatin in the promoter of the HMGN2 gene, thereby regulating HMGN2 protein levels in A549 cells We noticed that the expression of HBD-2 was decreased by only 40–50% when endogenous HMGN2 was knocked down The reason is that the efficiency of RNA interference and the signalling pathways that induce b-defensin expression upon LPS stimulation are not limited to NF-jB In addition, other members of the HMGN family that are structurally similar to HMGN2 may play a complementary role Some people have confirmed that depletion of HMG-14 and HMG-17 is associated with a delay in early embryonic development from the two- to four-cell stage, but depleting either one does not delay the development [45] In summary, we identified a novel mechanism by which HMGN2 modulates the expression of HBD-2 in A549 cells HMGN2 prolongs the retention time and enhances the accumulation of NF-jB p65 in the nucleus, and promotes the 2162 acetylation of p65 through increasing HAT activity Additionally, chromatin immunoprecipitation revealed that HMGN2 and p65 synergistically promote their specific binding to the HBD-2 promoter, thereby affecting downstream transcription Taken together, these results suggest that HMGN2 acts as a positive modulator of NF-kB signalling to promote LPSinduced b-defensin expression Materials and methods Materials The antibodies were p65 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), p65 (for ChIP; Abcum, Cambridge, UK), acetyl-p65 (Lys310) (Cell Signaling, Danvers, MA, USA), b-actin (Santa Cruz), histone H3 (Abcum) and HBD-2 (Santa Cruz) The affinity pure HMGN2 antibodies were prepared in our laboratory Escherichia coli LPS was from Sigma (St Louis, MO, USA) Cell culture Human lung adenocarcinoma A549 cells were obtained from the School of Pharmaceutical Science, Sun Yat-Sen University (Guangzhou, China) These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 °C in a humidified incubator containing 5% CO2 siRNA transfection Three HMGN2-specific siRNAs (1, and 3) (SiRNA-HMG N2-1: sense, 5¢-CUA AUA GAA UGU CUC CAA ATT-3¢; antisense, 5¢-UUU GGA GAC AUU CUA UUA GTG-3¢; SiRNA-HMGN2-2: sense, 5¢-AGU CAG GGU CGG CUU GUG ATT-3¢; antisense, 5¢-UCA CAA GCC GAC CCU GAC UTT-3¢; SiRNA-HMGN2-3: sense, 5¢-UAA UAG AAU GUC UCC AAA GTT-3¢; antisense, 5¢-CUU UGG AGA CAU UCU AUU AGT-3¢) and two non-specific control siRNAs (positive siRNA sense, 5¢-GAC TTC ATAA GGCG CATGC-3¢; antisense, 5¢- GCATGCGCCTTAT GAAGTC-3¢; negative siRNA sense, 5¢-AUU GUA UGC GAU CGC AGA CTT-3¢; antisense, 5¢-GUC UGC GAU CGC AUA CAA UGA-3¢) were designed and synthesized by RiboBio (Guangzhou, China) The positive control siRNA was targeted to the b-actin gene, while the negative control did not match any genes of known function in GenBank A549 cells were placed in six-well plates (Costar, CA, USA) at a density of · 105 cells per well After 24 h, cells were grown to 40–50% confluence and transfected by HMGN2specfic siRNA or control siRNAs using LipfectamineÔ 2000 (Invitrogen, Carlsbad, CA, USA) according to the FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al HMGN2 mediates expression of b-defensins Table A549 cell groups in microarray analysis Table A549 cell groups in this study Groups Description Groups Description Blank group (group A) HMGN2 knockdown group (group B) LPS group (group C) HMGN2 knockdown plus LPS group (group D) A549 cells untreated A549 cells transfected with HMGN2-specific siRNA2 A549 cell treated by 100 lgỈmL)1 LPS A549 cell transfected with HMGN2-specific siRNA2 for 48 h and then treated by 100 lgỈmL)1 LPS for 24 h PE-H group A549 cells stably transfected with PEGFPN1-HMGN2 A549 cells stably transfected with PEGFPN1 A549 cells treated by LPS A549 cells stably transfected with pSilencer-HMGN2-2 A549 cells stably transfected with pSilencer A549 cells stably transfected with pSilencer-HMGN2-2 and transfected with PEGFPN1-HMGN2 A549 cells stably transfected with pSilencer-HMGN2-2 and transfected with PEGFPN1 PE group B group Psi-H group Psi group Psi-H ⁄ PE-H group manufacturer’s instructions The medium was replaced h after transfection and the cells were cultured for 24 h before the efficiency of HMGN2 knockdown was determined Psi-H ⁄ PE group cDNA microarray and data analysis A549 cells were placed into six-well plates at a density of · 105 cells per well The cells were divided into four groups in triplicate (Table 3) The microarray was performed at Shanghai Biochip according to instructions from SBC GeneChips (shbiochip, Shanghai) Total RNA was isolated from A549 cells using Trizol (Invitrogen) following the manufacturer’s instructions About 10–20 lg RNA was converted to cDNA using an oligo (dT) T7 primer, and the double-stranded cDNA was labelled with Cy3 (as the reference sample) and Cy5 (as the treatment sample), respectively The double-stranded cDNA was purified and used as a template in subsequent transcription reactions The labelled cDNA probes for the four groups were mixed with hybridization buffer The samples were hybridized competitively under coverslips to the microarray slides at 50 °C for 16 h in a dark humidity chamber and washed as follows: · NaCl ⁄ Cit for min, 0.5 · NaCl ⁄ Cit for min, and 30% ethanol ⁄ water for 30 s at 42 °C Hybridization experiments were performed in duplicate using cDNA derived from the four different groups Images were scanned and analysed by the Agilent GeneChip Scanner The original signals of the images were normalized using the reference spots on the slide and the fluorescence signals were balanced and amended using the genespring software Three biological replicates (independent RNA isolations), each with a technical replicate (dye swap), were performed for each condition Genes with a Cy5 ⁄ Cy3 signal ratio ‡ 2.0 were considered upregulated, whereas those with a ratio £ 0.5 were downregulated Plasmid constructs Short hairpin (sh) RNA constructs were prepared using pSilencer 4.0-CMV (Ambion, Austin, TX, USA) as the vector The HMGN2-shRNA plasmids were named pSilencerHMGN2-1 and pSilencer-HMGN2-2, respectively (HM GN2-shRNA-1: sense, 5¢-GATCCTCTGCGAGGTTGTC TGCTATTCAAGAGATAGCAGACAACCTCGCAGAT CA-3¢; antisense, 5¢-AGCTTGATCTGCGAGGTTGTCTG CTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢; HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGAGATGC CAAAACATTCAAGAGATGTTTTGGCATCTCCATTT TCA-3¢;antisense, 5¢-AGCTTGAAAATGGAGATGCCAA AACATCTCTTGAATGTTTTGGCATCTCCATTTG-3¢) Additional shRNAs were used as positive and negative controls (positive shRNA: sense, 5¢-GATCCCGTATATGATA CCAACAGTAATTC AAGAGATTACTGTTGGTATCA TATACGTTTTCA-3¢; antisense, 5¢-AGCTTT GAAAACG TATATGATACCAACAGTAATCTCTTGAATTACTGT TGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-G ATCCGACTTCATAAGGCGACTGCT TCAAGACGGC ATGCGCCTTATGAAGTCTTTTTTGTCGACA-3¢; antisense, 5¢-AGCTTAGTTCGACAAAAAAGACTTCTTCAT AAGGCGCATGCCGTCTTGAAGCACGCCTTATGAA GT-3¢) The complete HMGN2 cDNA was amplified from the total RNA of A549 cells by RT-PCR with the primers 5¢-CACCATGGCGGAAGGCGGAGCGGC-3¢ and 5¢-GT TAGTGTGCATACAGTTTT-3¢, and cloned into PEGFP N1 vector (Invitrogen) The positive clone was verified by DNA sequencing and named as PEGFPN1-HMGN2 Establishment of stable cell lines A549 cells were seeded in 12-well plates at a density of · 105 cells per well Following overnight incubation in DMEM containing 10% FBS at 37 °C in 5% CO2, pSilencer-HMGN2-1, pSilencer-HMGN2-2, PEGFPN1-HMGN2 or the control vector was transfected into A549 cells using LipofectamineÔ 2000 (Invitrogen) as per the manufacturer’s instructions Resistant colonies were selected by G418 at 800 lgỈmL)1 based on the killing curve patterns for A549 cells Single clones were picked and tested for FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2163 HMGN2 mediates expression of b-defensins L.-X Deng et al Table Primers for HMGN2 and HBD-2 Primers Sequences HMGN2 sense HMGN2 antisense HBD-2 sense HBD-2 antisense 5¢-CGATG CCC AAG AGA AAG G-3¢ 5¢-GCAA CTT GGC ATC TCC AGC A-3¢ 5¢-CCAGCCATCAGCCATGAGGGT-3¢ 5¢-GGAGCCCTTTCTGAATCCGCA-3¢ co-transfected with 200 ng reporter plasmid pGL3-3 · jBLuc and pRL-TK (Promega) using Lipfectomine 2000 (Invitrogen) Then the cells were untreated or treated with LPS (100 lgỈmL)1) for h before the cell lysate was collected by passive lysis for luciferase activity assay The experiments were done in triplicate for each group ChIP assay and Co-IP HMGN2 expression by RT-PCR and western blot The stable A549 cell lines are listed in Table RNA isolation, RT-PCR and real time PCR Total RNA was isolated from A549 cells in the seven groups using Trizol (Invitrogen) following the manufacturer’s instructions cDNA was synthesized from lg RNA with high quality (260 versus 280 nm: 1.8–2.0) The resulting cDNA was analysed by SYBR Green PCR kit or normal RT-PCR kit according to the manufacturers’ protocols lL cDNA was amplified in a 25 lL reaction mix containing 22.5 lL SYBR Green supermix (Bio-Rad, CA, USA) and lL each primer (Table 5) The amplification conditions were initial denaturation at 95 °C for 15 min, 35 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s and elongation at 72 °C for 30 s To determine HBD-2 mRNA level, the experiment was repeated three times under each experimental condition and the comparative threshold cycle method was employed with human b-actin as the internal control Analysis of relative gene expression data using real-time quantitative PCR and the )2DDCT method [46] Western blot Whole cell lysate was extracted from A549 cells using Protein Extraction Reagent (Pierce, Rockford, IL, USA) Alternatively, the cytoplasmic and nuclear extracts were extracted from A549 cells using NE-PER nuclear and cytoplasmic extraction reagents (Pierce) following the manufacturer’s instructions The protein concentration of the extract was determined using the BCA protein assay (Pierce) The proteins were separated with SDS ⁄ PAGE and transferred to poly(vinylidene difluoride) membranes The membranes were incubated with HBD-2 (1 : 1000, Santa Cruz), HMGN2 (1 : 500, Santa Cruz), NF-jB p65 (1 : 1000, Santa Cruz), histone H3 (1 : 1000, Santa Cruz) or b-actin (1 : 1000, Santa Cruz) antibody followed by incubation with the horseradish peroxidase conjugated antigoat IgG serum (Santa Cruz) Finally the membranes were developed using ECL Plus reagent (Pierce) Luciferase assay Stable A549 cells were placed in 24-well plates at a density of 2.5 · 105 cells per well After 24 h the cells were 2164 ChIP assay was performed using ChIP IT express kit (Active Motif, Carlsbad, CA, USA) Briefly, A549 cells were treated with 100 lgỈmL)1 LPS for h, fixed with 1% formaldehyde for 10 at room temperature, sonicated to  500 bp soluble DNA fragments and immunoprecipitated with specific antibodies Antibodies for ChIP experiments included affinity pure HMGN2 or p65 antibody, or IgG (Upstate Biotechnology, Lake Placid, NY, USA) as the negative control, and the primers used for ChIP are given in Table S1 Immunoprecipitated DNA was analysed and the relative enrichment value was calculated as described previously [19] Co-IP was conducted using the nuclear complex Co-IP kit (Active Motif) Nuclear extracts of A549 cells were prepared and precipitated with affinity pure HMGN2 or p65 antibody, and the co-precipitated proteins were detected by western blot Acknowledgements The research was supported by grants from the National Natural Science Foundation of China (No 30671963, No 30470763 and CMB 98681).We thank Dr Bustin (NIH) for advice on the experiments and Dr Yingqun Wang for revising the manuscript Conflict of interest The authors declare that there is no conflict of interest References Van Wetering S, Sterk PJ, Rabe KF & Hiemstra PS (1999) Defensins: key players or bystanders in infection, injury, and repair in the lung? J Allergy Clin Immunol 104, 1131–1138 Schutte BC & McCray PB Jr (2002) b-defensins in lung host defense Annu Rev Physiol 64, 709–748 Oppenheim JJ, Biragyn A, Kwak LW & Yang D (2003) Roles of antimicrobial peptides such as defensins in innate and adaptive immunity Ann Rheum Dis 62, ii17–ii21 Tsutsumi-Ishii Y & Nagaoka I (2003) Modulation of human beta defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS L.-X Deng et al 10 11 12 13 14 15 16 17 18 mononuclear phagocytes via proinflammatory cytokine production J Immunol 170, 4226–4236 Goldman MJ, Anderson GM, Stolzenberg ED, Kari UP, Zasloff M & Wilson JM (1997) Human b-defensin1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis Cell Press 88, 553–560 Liu L, Roberts AA & Ganz T (2003) By IL-1 signaling, monocyte-derived cells dramatically enhance the epidermal antimicrobial response to lipopolysaccharide J Immunol 170, 575–580 Jang BC, Lim KJ, Suh MH, Park JG & Suh SI (2007) Dexamethasone suppresses interleukin-1 b-induced human b-defensin mRNA expression: involvement of p38 MAPK, JNK, MKP-1, and NF-jB transcriptional factor in A549 cells FEMS Immunol Med Microbiol 51, 171–184 May MJ & Ghosh S (1988) Signal transduction though NF-jB Immunol Today 19, 80–88 Chen FE, Huang DB, Chen YQ & Ghosh G (1998) Crystal structure of p50 ⁄ p65 heterodimer of transcription factor NF-jB bound to DNA Nature 391, 410–413 Beg AA, Finco TS, Nantermet PV & Baldwin AS Jr (1993) Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of IjB-a: a mechanism for NF-jB activation Mol Cell Biol 13, 3301–3310 Baeuerle PA & Baltimore D (1988) Activation of DNAbinding activity in an apparently cytoplasmic precursor of the NF-jB transcription factor Cell 53, 211–217 Bustin M (2001) Chromatin unfolding and activation by HMGN chromosomal proteins Trends Biochem Sci 26, 431–437 Lim JH, West KL, Rubinstein Y, Bergel M, Postnikov YV & Bustin M (2005) Chromosomal protein HMGN1 enhances the acetylation of lysine 14 in histone H3 EMBO J 24, 3038–3048 Trieschmann L, Postnikov YV, Rickers A & Bustin M (1995) Modular structure of chromosomal proteins HMG-14 and HMG-17: definition of a transcriptional activation domain distinct from the nucleosomal binding domain Mol Cell Biol 15, 6663–6669 Bustin M (1999) Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins Mol Cell Biol 19, 5237–5246 Cleynen I, Brants JR, Peeters K, Deckers R, DebiecRychter M, Sciot R, Van De Ven WJ & Petit MM (2007) HMGA2 regulates transcription of the Imp2 gene via an intronic regulatory element in cooperation with nuclear factor-jB Mol Cancer Res 5, 363–372 Mantovani F, Covaceuszach S, Rustighi A, Sgarra R, Heath C, Goodwin GH & Manfioletti G (1998) NF-jB mediated transcriptional activation is enhanced by the architectural factor HMGI-C Nucleic Acids Res 26, 1433–1439 Zaalouk TK, Elliott MB, George JT & McDonald V (2004) Differential regulation of b-defensin gene expres- HMGN2 mediates expression of b-defensins 19 20 21 22 23 24 25 26 27 28 29 30 sion during Cryptosporidium parvum infection Infect Immun 72, 2772–2779 Ashburner BP, Westerheide SD & Baldwin AS Jr (2001) The p65 (RelA) subunit of NF-kB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression Mol Cell Biol 21, 7065–7077 Chen L, Fischle W, Verdin E & Greene WC (2001) Duration of nuclear NF-jB action regulated by reversible acetylation Science 293, 1653–1657 Chen LF, Mu Y & Greene WC (2002) Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-jB EMBO J 21, 6539–6548 Gao Z, Chiao P, Zhang X, Zhang X, Lazar MA, Seto E, Young HA & Ye J (2005) Coactivators and corepressors of NF-jB in IjB alpha gene promoter J Biol Chem 280, 21091–21098 Yoshida M, Hoshikawa Y, Koseki K, Mori K & Beppu T (1990) Structural specificity for biological activity of Trichostatin A, a specific inhibitor of mammalian cell cycle with potent differentiation-inducing activity in Friend leukemia cells J Antibiot (Tokyo) 43, 1101–1106 Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I & Coombes RC (2001) TSA is a histone deacetylase inhibitor with potent antitumour activity against breast cancer in vivo Clin Cancer Res 7, 971–976 Kwon HJ, Owa T, Hassig CA, Shimada J & Schreiber SL (1998) Depudecin induces morphological reversion of transformed fibroblasts via the inhibition of histone deacetylase Proc Natl Acad Sci USA 95, 3356–3361 Sung B, Pandey MK, Ahn KS, Yi T, Chaturvedi MM, Liu M & Aggarwal BB (2008) Anacardic acid (6-nonadecyl salicylic acid), an inhibitor of histone acetyltransferase, suppresses expression of nuclear factor-jB-regulated gene products involved in cell survival, proliferation, invasion, and inflammation through inhibition of the inhibitory subunit of nuclear factor-jBa kinase, leading to potentiation of apoptosis Blood 111, 4880–4891 Reeves R & Candido EP (1980) Partial inhibition of histone deacetylase in active chromatin by HMG 14 and HMG 17 Nucleic Acids Res 8, 1947–1963 Ueda T, Furusawa T, Kurahashi T, Tessarollo L & Bustin M (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion Mol Cell Biol 29, 5264–5276 Korner U, Bustin M, Scheer U & Hock R (2003) Developmental role of HMGN proteins in Xenopus laevis Mech Dev 120, 1177–1192 Rubinstein YR, Furusawa T, Lim JH, Postnikov YV, West KL, Birger Y, Lee S, Nguyen P, Trepel JB & Bustin M (2005) Chromosomal protein HMGN1 modulates the expression of N-cadherin FEBS J 272, 5853–5863 FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS 2165 HMGN2 mediates expression of b-defensins L.-X Deng et al 31 Furusawa T, Lim JH, Catez F, Birger Y, Mackem S & Bustin M (2006) Down-regulation of nucleosomal binding protein HMGN1 expression during embryogenesis modulates Sox9 expression in chondrocytes Mol Cell Biol 26, 592–604 32 Amen M, Espinoza HM, Cox C, Liang X, Wang J, Link TM, Brennan RG, Martin JF & Amendt BA (2007) Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt ⁄ b-catenin signaling Nucleic Acids Res 36, 462–476 33 Belova GI, Postnikov YV, Furusawa T, Birger Y & Bustin M (2008) Chromosomal protein HMGN1 enhances the heat shock-induced remodeling of Hsp70 chromatin J Biol Chem 283, 8080–8088 34 Feng Y, Huang N, Wu Q & Wang B (2005) HMGN2: a novel antimicrobial effector molecule of human mononuclear leukocytes? J Leukoc Biol 78, 1136–1141 35 Deng L, Pan X, Wang Y, Wang L, Zhou XE, Li M, Feng Y, Wu Q, Wang B & Huang N (2009) Hemoglobin and its derived peptides may play a role in the antibacterial mechanism of the vagina Hum Reprod 24, 211–218 36 Becker MN, Diamond G, Verghese MW & Randell SH (2000) CD14-dependent lipopolysaccharide-induced beta-defensin-2 expression in human tracheobronchial epithelium J Biol Chem 275, 29731–29736 37 Song PI, Abraham TA, Park Y, Zivony AS, Harten B, Edelhauser HF, Ward SL, Armstrong CA & Ansel JC (2001) The expression of functional LPS receptor proteins CD14 and toll-like receptor in human corneal cells Invest Ophthalmol Vis Sci 42, 2867–2877 38 Tsutsumi-Ishii Y & Nagaoka I (2002) NF-j B-mediated transcriptional regulation of human b-defensin-2 gene following lipopolysaccharide stimulation J Leukoc Biol 71, 154–162 39 Kim JM, Kim JS, Jung HC, Oh YK, Kim N & Song IS (2003) Inhibition of Helicobacter pylori-induced nuclear factor-j B activation and interleukin-8 gene expression by ecabet sodium in gastric epithelial cells Helicobacter 8, 542–553 40 Brown CE, Lechner T, Howe L & Workman JL (2000) The many HATs of transcription coactivators Trends Biochem Sci 25, 15–19 41 Ishinaga H, Jono H, Lim JH, Kweon SM, Xu H, Ha UH, Xu H, Koga T, Yan C, Feng XH et al (2007) TGF-beta induces p65 acetylation to enhance bacteriainduced NF-jB activation EMBO J 26, 1150–1162 42 Schwab M, Reynders V, Loitsch S, Steinhilber D, Schroder O & Stein J (2008) The dietary histone deacetylase inhibitor sulforaphane induces human b-defensin-2 in intestinal epithelial cells Immunology 125, 241–251 43 Schauber J, Iffland K, Frisch S, Kudlich T, Schmausser B, Eck M, Menzel T, Gostner A, Luhrs H & Scheppach ă 2166 W (2004) Histone-deacetylase inhibitors induce the cathelicidin LL-37 in gastrointestinal cells Mol Immunol 41, 847–854 44 Agresti A, Scaffidi P, Riva A, Caiolfa VR & Bianchi ME (2005) GR and HMGB1 interact only within chromatin and influence each other’s residence time Mol Cell 18, 109–121 45 Mohamed OA, Bustin M & Clarke HJ (2001) Highmobility group proteins 14 and 17 maintain the timing of early embryonic development in the mouse Dev Biol 229, 237–249 46 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2)DDCt Method Methods 25, 402–408 Supporting information The following supplementary material is available: Fig S1 HMGN2 expression is not affected by LPS stimulation in A549 cells Fig S2 The quantity of RNA in four groups was detected by NanoDrop ND-1000 Fig S3 (A) The boxplot of the microarray (B) Part of the gene map changed significantly in four groups The red colour indicated upregulated genes with a detection ratio ‡ 2, while the green colour indicated downregulated genes with a detection ratio £ 0.5 (C) The diagrammatic sketch of the microarray Fig S4 (A) The fragment of HMGN2 cDNA detected by RT-PCR and HMGN2 protein detected by western blotting: B, blank group; 1, pSilencer-HMGN2-1; 2, pSilencer-HMGN2-2 (B) Representative RT-PCR and western blotting images are shown b-actin served as the loading control for PCR, while histone H3 served as the loading control for western blotting Fig S5 HMGN2 has no effect on the proliferation of A549 cells Fig S6 ChIP assay demonstrated that HMGN2 and HMGN1 in normal A549 cells and HMGN1 in HMGN2 knockdown A549 cells bind to HBD-2 chromatin Fig S7 Model for the regulation of transcriptional activity by HMGN2 to HBD-2 expression Table S1 The primers used for ChIP This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 278 (2011) 2152–2166 ª 2011 The Authors Journal compilation ª 2011 FEBS ... amplification of the corresponding part of HMGN2 cDNA) In A549 cells, replenishment of HMGN2 protein upregulated the protein levels of HBD-2, an indication that the levels of this protein are indeed linked... Based on these data, we propose that HMGN2 and p65 mutually reinforce their specific binding to the chromatin in the promoter of the HMGN2 gene, thereby regulating HMGN2 protein levels in A549 cells. .. perhaps involving HMGN2, compensate for the loss of the HMGN1 protein based on structural similarity among them Indeed, the ChIP analyses in that study indicated an increase of HMGN2 in the Sox9