... wrote the first draft of the manuscript JJ, JC and JMA contributed to the final version of the manuscript GA, RB-D and AR helped in the data analysis and interpretation JJ and JC supervised the ... changes in the pattern of chemokine gene expression in circulating leukocytes The data suggest that PPARα activators may be useful in the attempt to decrease the risk of atherosclerosis and may ... significant effect of fenofibrate in the MCP-1/CCL2 gene expression However, there was a significant decrease in the gene expression of the CX3CL1/ Fractalkine in patients treated with fenofibrate with...
Ngày tải lên: 10/08/2014, 05:21
... matures in the cytoplasm The synthesis and maturation of HCV is presumed to occur in the cytoplasm This, in our opinion, is an evolving concept We have seen HCV particles in the nucleus, in the perinuclear ... reported in the brain environment [25-27] These observations may partly explain the diminished cognitive function, depression and fatigue in these individuals The presence of HIV1 and HCV in the same ... were seen in the cytoplasm and in the vicinity of budding HHV-6A particles (Figure 7B), and other incomplete HCV particles were also seen in the perinuclear space (Figures 7A and 7D) These HCV...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" pptx
... matures in the cytoplasm The synthesis and maturation of HCV is presumed to occur in the cytoplasm This, in our opinion, is an evolving concept We have seen HCV particles in the nucleus, in the perinuclear ... reported in the brain environment [25-27] These observations may partly explain the diminished cognitive function, depression and fatigue in these individuals The presence of HIV1 and HCV in the same ... were seen in the cytoplasm and in the vicinity of budding HHV-6A particles (Figure 7B), and other incomplete HCV particles were also seen in the perinuclear space (Figures 7A and 7D) These HCV...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Inhibition of cytokine gene expression and induction of chemokine genes in non-lymphatic cells infected with SARS coronavirus" doc
... including the lungs [8,14] Our data may explain this rapid and efficient dissemination of SARS-CoV By slowing down expression of IFNs and their antiviral genes in the infected tissue cells, the ... both the Caco-2 cells and the low passage HEK 293 cells as useful systems for studying the influence of SARS- CoV on the immune system-independent induction of cytokines Interferon genes and their ... studies and the RT-PCR analyses, participated in the design of the study, and has given final approval of the version to be published FW carried out virus infections, participated in the design of the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: " Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence" pps
... studied Of the seven genes examined in this study, the levels of expression of IFN-g, IL-2 and IL12P40 genes in the bursa tissues following H strain infection were increased compared with the IL-4, ... expression of IL-5 mRNA in the bursa of birds infected with the H strain increased continuously, peaking at dpi with a 7.47-fold increase (P = 0.00002) (Figure 3C) The expression of the IL-4 gene in the ... examining the transcriptional profile of cytokines in the bursal tissues of chickens infected with either vvIBDV H strain or the cell-adapted virus Ts strain at 1, and days postinfection (dpi) and...
Ngày tải lên: 11/08/2014, 21:21
Environmental Injustice and Human Rights Abuse: The States, MNCs, and Repression of Minority Groups in the World System pptx
... rain forest, the massacre of Father Nery Lito Satur and several others in the Philippines, and the public hanging of Ken Saro-Wiwa and eight other members of the Movement for the Survival of the ... waste dumping, natural resource exploitation, and the consequent degradation of the means of subsistence of indigenous people The roles of the state and MNCs in suppressing the rights of communal ... policies and official behavior toward the non-core countries Basically, institutionalized discrimination refers to the policies of the dominant institutions in the core and the behavior of individuals...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot
... role of the N-terminal part of the kinase, containing a PAS domain, was established in signal transduction between the RH and the kinase [6,7] Addition of H2 to HupUV before or during the incubation ... inactive [26] Comparison of HupSL regulations and the functional roles of HupTUV in other T roseopersicina strains would provide further insight into the understanding of the loss of HupSL hydrogenase ... suggest that the transcript level of the hupTUV genes is below the detection limit or is missing in T roseopersicina Mutagenesis and homologous expression of the hupT and hupTUV genes In- frame deletion...
Ngày tải lên: 16/03/2014, 23:20
expression of recombinant genes in eukaryotic systems
... constructs in cell lines or transgenic mice offers the advantage of determining the function of regulatory elements after integration into the genome and assimilation into chromatin i p j Laybourn and ... probes to genes whose expression is not expected to vary in the experiment (in yeast, probes complementary to the genes encoding actin and the TATAbinding protein have been used) or spots of total ... expressed in COS cells shows incomplete protein processing as reflected by a smear of bands on the gel as a consequence of the overwhelming amount of plasmid DNA and subsequent protein present in the...
Ngày tải lên: 11/04/2014, 09:41
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... testing of these models [reviewed in 58] and further broad comparative studies, including normal and aberrant flowers in a range of species, will aid understanding of the mechanisms underlying the ... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... protein is required for sepal and petal identity On the other hand, the role of euAP1 genes in specification of sepal and petal identity in plants other than Arabidopsis is unclear and the concept...
Ngày tải lên: 11/08/2014, 11:22
Báo cáo y học: "Bench-to-bedside review: Developmental influences on the mechanisms, treatment and outcomes of cardiovascular dysfunction in neonatal versus adult sepsis" ppt
... levels of proinflammatory cytokines including IL-1β, IL-6, IL-8 and TNFα [12] LPS is a cell wall component of Gram-negative bacteria, and is the main endotoxin implicated in the initiation of the ... for the conception and design of the present review, as well as the intellectual content, drafting and revision of the manuscript TMH and JAB also contributed significantly to the design of the ... cardiomyocyte differs from that of the adult and may lead to differences in the cardiac response to sepsis and inflammation In addition to underlying differences in the structure of the neonatal cardiomyocyte,...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo sinh học: "The nature, scope and impact of genomic prediction in beef cattle in the United States" pdf
... throughout the production, finishing and processing system; and welfare factors, both of the animals in terms of exhibiting natural behaviors and being free of disease, suffering, and mortality, and of ... research, as the training population grows in terms of numbers of genotyped animals, and density of SNP genotypes per animal Phenotyping is now the principal limitation in expanding the series of traits ... measure in most processing plants In the US, carcass marbling has been used as a surrogate for tenderness/eating quality More recently, QTL in the region of the calpain and calpastatin genes have...
Ngày tải lên: 14/08/2014, 13:21
Expression of EBV genes in nasopharyngeal carcinoma
... expression and inhibit expression of intron-containing genes (Ruvolo et al., 1998) In contrast to the majority of cellular genes, many EBV genes expressed during lytic cycle are intronless, and ... defined as that portion of the pharynx which lies behind the nasal fossae and extends inferiorly as far as the level of the soft plate Nasopharyngeal carcinoma usually originates in the fossa of ... cause methylation of some promoters of cellular genes, including the promoters of tumour suppressor genes, and results in down-regulation of the expression of these tumour suppressor genes 1.2.5.1.2...
Ngày tải lên: 05/10/2015, 22:32
báo cáo khoa học: " Comparative genomic analysis and expression of the APETALA2-like genes from barley, wheat, and barley-wheat amphiploids" pdf
... to understanding the role of the AP2like gene in the spike morphology of barley and wheat and in hybrids obtained from their crossing and for modification of the expression of AP2-like genes to ... parental The chromosome substitutions 1D/1Hch and 2D/2Hch influence the expression of the barley AP2 in tritordeum The results are of interest in understanding the role of the AP2-like gene in the ... Alignments of the sequenced cDNA and DNA of the H chilense lines H11 and H208, and H vulgare line H106 have shown that the internal structure of exons and introns of the AP2-like gene described in this...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Báo cáo khoa học: Molecular characterization, phylogenetic relationships, and developmental expression patterns of prion genes in zebrafish (Danio rerio) doc
... al depends in part on the homology between the donor pathogen protein and the natural physiological protein present in the receiver, both in the amino acid sequence of the protein and in its tridimensional ... (h), and intestinal epithelium (ie) (M, insert) of the posterior intestine (pi) In the CNS, the labeled divisions are the telencephalon (t), mesencephalon (m) including the optic tectum (ot), the ... part of the intestine (Fig 5M,Q,R) This last finding should be of interest because in terms of function, the fish intestine is highly regionalized both in the larva and in the adult [38] The posterior...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
... on the right side of the figure The transmembranous domains of the protein at the N- and C-terminus are shaded The five apyrase conserved regions (ACRs) are underlined and in bold The 10 cysteine ... in the apical membranes of the oxyntic-peptic cells [37] The distribution of the ectoATPDase on these epithelial cells is distinctly different from the other ATPDase in the E-ATPase family, the ... suramin, the former activates while the latter inhibits the chicken smooth muscle ecto-ATPase [23,28] On the other hand, it was inhibited by high concentrations of azide, an inhibitor of CD39 and...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... and 3¢-UTR The major differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the ... 32739 Li R, Hartley L & Robb L (2001) Cloning of rat interleukin 11 and interleukin 11 receptor alpha chain and analysis of their expression in rat uterus in the periimplantation period Reproduction ... AJ535687) and amino acid (lower line) sequence are numbered on the left according to the submitted sequences The 5¢- and 3¢-flanking and intron sequences are in lowercase Identical nucleotides in the...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... different cDNAs coding for the subunits A and B of V-ATPase The intracellular localization of these isoforms and the combination of the isoforms is yet to be determined We are now trying to express ... divergent in group and proteins The results we obtained indicate that these two domains may play a critical role in complementability The genes AACEVAPD1 and were constructed in another yeast expression ... ratio of the three proteins could not be estimated Forgac described in a recent minireview [21] that the VO domain consisted of six copies of the c/c0 subunits and single copies of the other subunits...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26] Comparative analysis of the ... number of regions even more conserved (Fig 1) All 12 cysteine residues in the aminoterminal part of APLP2 are present in X-APLP2 The zinc-binding domain consensus sequence (GxExVCCP [13]) in the ... proteins are 91% and 100% identical, respectively, including the GYENPTY sequence that is present in all APP superfamily members and is involved in the intracellular routing of the proteins [17]...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... produced in the skin The level of 7-DHP production and its hypothetical conversion into other metabolites (including 17-, 20-, 21- and 11-hydroxy-7DHP) are the subject of investigations in our ... that the genes and proteins required for the P450scc system are expressed concomitantly in the skin and skin cells Moreover, using an array of methods including chemical synthesis with TLC and ... parameters for the 7-DHC; the retention time for its ion with m/z 385.3 and UV spectra are shown in the inset in (B) and in inset in (D) These results are in agreement with recent findings of Thiboutot...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khóa học: Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucose ppt
... and the corresponding gene has been cloned from human [23] In the present study we have cloned the murine genes coding for the enzymes involved in the salvage pathway of GDP-L-fucose L-fucokinase ... variants of the murine fucokinase genes were expressed in COS-7 cells in frame with a 10-amino acid E2Tag present in the pQM vector The molecular masses of fucokinase proteins were determined by ... human fucokinase cDNA is similar to the long splice variant of mouse fucokinase cDNA at the 3¢ splice region The first and third methionines in the murine sequence, in the upstream end of the CDS,...
Ngày tải lên: 30/03/2014, 13:20