FLORAL RECEPTACLE CULTURE IN VITRO AND PLANTLET REGENERATION IN GERBERA JAMESONII BOLUS

... all-trans -retinoic acid, the findings clearly demonstrate that S-4o9cDH-RA has the capacity to bind and activate nuclear retinoid receptors and regulate gene transcription both in vitro and in vivo Retinoids ... (reviewed in [1–5]) All-trans -retinoic acid (at-RA) is the most active naturally occurring retinoid in mammals, except for the visual process, wh...

Ngày tải lên: 18/02/2014, 08:20

... WORKING WITH ETHNICITY, RACE AND CULTURE IN MENTAL HEALTH of related interest Advance Directives in Mental Health Theory, Practice and Ethics Jacqueline Atkinson ISBN 978 84310 483 Racism and ... is culture a nebulous concept; it is also barely reliably (or universally) defined by those within it 20 / WORKING WITH ETHNICITY, RACE AND CULTURE IN ME...

Ngày tải lên: 06/03/2014, 02:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAA...

Ngày tải lên: 07/03/2014, 21:20

... detection of AFB in sputum samples of patients with pulmonary tuberculosis in tertiary healthcare facilities which have a large number of cases and financial constraints Ethical Approval The study was ... (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints The present study aimed to re-eval...

Ngày tải lên: 15/03/2014, 03:20

... in timing of diagnosis of the disease; and (4) disparities in access to care to treat the disease Although each of these issues is distinct, they are interconnected in creating and perpetuating ... in timing of diagnosis of the disease; and (4) disparities in access to care to treat the disease Although each of these issues is distinct, they are interco...

Ngày tải lên: 22/03/2014, 14:20

... 271) strain 80204-1 produced under in vitro growth conditions on tryptic soy agar (TSA) and in vivo and have demonstrated that their structures are chemically and antigenically distinct from the ... TOF Analysis of the in vivo cultured A salmonicida strain 80204-1 cells In vivo culture was performed using ligated dialysis tubing bags filled with ba...

Ngày tải lên: 23/03/2014, 13:20

... collected and analyzed by SDS/PAGE In vitro self-cleavage of S pneumoniae SPase I For in vitro self-cleavage of S pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing lg of ... dramatic decrease of the enzymatic activity, implying that the self-cleavage, if occurring in vivo, may play an important role in the regulation of...

Ngày tải lên: 23/03/2014, 21:21

... for the Arts Indeed, among the areas in our sample, the fastest growing places (Charlotte and Phoenix) were more inclined to invest in the arts than were the declining areas 28 Arts and Culture ... division of the RAND Corporation iii Other RAND Books on the Arts A New Framework for Building Participation in the Arts (2001) Kevin F McCarthy and Kimberl...

Ngày tải lên: 29/03/2014, 20:20

... question of whether introduction of the bisecting GlcNAc changes the ligand properties (binding affinities) of biantennary N-glycans for branch-end-specific lectins as well as for cells and organs ... [37] N-glycans [37] in Table The general conclusion is that the presence of a bisecting GlcNAc affects lectin affinity In the case of mistletoe lectin, the intr...

Ngày tải lên: 30/03/2014, 13:20

... differentiate between folded and unfolded proteins The requirement for a specific binding characteristic in phage-display is a serious restriction, because folded proteins not have general binding characteristics ... protein domains arose is thus not clear These difficulties pose interesting questions relating to the understanding of both protein evolution and protein engineerin...

Ngày tải lên: 30/03/2014, 13:20

... contributed to the design of the experiments and analysis of the data KAK contributed to the acquisition and interpretation of data RWM contributed to the conception of the studies and the critical ... with the gfp gene driven by the synthetic E/L promoter (black arrow in the bottom line) The resulting virus was designated VV Δ F2L-gfp and contained a...

Ngày tải lên: 20/06/2014, 01:20

... study of the effects of isatin, an endogenous MAO -inhibitor, and seleginine on bradykinasia and dopamine levels in a rat model Parkinson's disease induced by the Japanese encephalitis virus Neurotoxicology ... control, lanes and – in vitro translation products of RNA obtained form JEV infected PS cells (untreated) at and 10 hours post infection respectively Lane...

Ngày tải lên: 20/06/2014, 01:20

... Rogel Arie, et al.: Inhibition of foot -and- mouth disease virus replication by small interfering RNA Journal of General Virology 2004, 85:3213-3217 Publish with Bio Med Central and every scientist ... Sharp PA: siRNA-directed inhibition of HIV-1 infection Nat Med 2002, 8:681-686 Shlomai A, Shaul Y: Inhibition of hepatitis B virus expression and replication...

Ngày tải lên: 20/06/2014, 01:20