Development of vorinostat loaded solid lipid nanoparticles to enhance pharmacokinetics and efficacy against multidrug resistant cancer cells

... 30 Yassin AE, Alsarra IA, Alanazi FK, et al New targeted -colon delivery system: in vitro and in vivo evaluation using x-ray imaging J Drug Target 2010; 18: 59-66 31 Alanazi FK, Yassin A, El-Badry ... Germany) Table 1, represents the exact composition of each of the prepared formula The effect of different formulation parameters, such as type of Dynasan, soyalicithin:Dynasan ratio,...

Ngày tải lên: 25/10/2012, 11:22

... objective of this study is to develop optical phase evaluation techniques for fringe projection and digital speckle measurement, and to overcome existing problems in the area of optical fringe analysis ... developing process Digital speckle method refers to a broad range of speckle metrology techniques including TV holography (Butters and Leender...

Ngày tải lên: 16/09/2015, 08:30

... OF VIETNAM ENERGY DEVELOPMENT SUPPORT JOINT STOCK COMPANY As a young company in the field of import of energy -supported equipment, the Vietnam energy development import support joint stock company ... of import activities of Vietnam energy development support joint stock company in recent years 3.1 The real situation...

Ngày tải lên: 24/07/2013, 09:11

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

... clusters of retained items within each of the 14 individual domains and then on the resultant item pool in its entirety after item elimination at the domain level In Rasch analysis, a mathematical ... al.: Development of the ATAQ-IPF: a tool to assess quality of life in IPF Health and Quality of Life Outcomes 2010 8:77 Submit your next manuscript...

Ngày tải lên: 20/06/2014, 16:20

... effector of PDT Therefore, photosensitizer loaded silica nanoparticles are different from conventional delivery systems which need releasing of the loaded drug [9] Previous investigations of fluorescent -magnetic ... fluorescent -magnetic nanoparticles mainly focused on the MRI imaging and fluorescence imaging for diagnosis; however, there are few studies on the mul...

Ngày tải lên: 22/06/2014, 01:20

... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Takahashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, ... corresponding to Aux/IAA genes Motif Transcription Factor Family*1 ([ACGT]GAA [ACGT]){3} TGACAGGT CCAC [AC ]A [ACGT] [AC] [ACGT] [CT] [AC] GG [ACGT]CCCAC GTGG [ACGT]CCC CAACA [ACGT]*CACCTG A [T...

Ngày tải lên: 12/08/2014, 05:20

... DEVELOPMENT OF NOVEL MICROEXTRACTION METHODS WITH APPLICATION TO ENVIRONMENTAL ANALYSIS BY XIANMIN JIANG A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMISTRY ... the application of these techniques to trace environmental analysis These novel microextraction techniques include the use of a new type of fiber for SPME; a n...

Ngày tải lên: 15/09/2015, 17:09

... containing alginate and fish oil for spray drying 2) To optimize spray drying conditions for the production of microspheres containing alginate as wall material 3) To investigate the effect of alginate ... hypothesized that the use of alginates as wall material can enhance the oil- loading capacities of microspheres produced by spray drying In addition, the...

Ngày tải lên: 30/09/2015, 06:28

... preponderant role of p38 in the regulation of gene expression at the level of mRNA stability The p38 MAP kinase is now known to stabilize a wide range of mRNAs including those encoding TNF-a, interferon ... organization of the actin cytoskeleton and the superinduction of the CTGF/ CCN2 gene Rho-like GTPases play a pivotal role in orchestrating changes...

Ngày tải lên: 19/02/2014, 16:20

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

Ngày tải lên: 15/03/2014, 23:56

... model AFI of 2¢,5¢ d(G4C4), possesses composite features of both A and BDNA In view of these, it is perhaps appropriate to regard the structure of iso d(G4C4) as a hybrid structure of A and B forms ... winding of the 2¢,5¢ single-stranded DNA helix, compared with 3¢,5¢ DNA, probably offers restrictions to the folding abilities of even single-stranded 2¢,5¢...

Ngày tải lên: 16/03/2014, 18:20

... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without ... permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproductio...

Ngày tải lên: 03/06/2014, 02:11