Ngày tải lên: 20/06/2014, 16:20
Ngày tải lên: 29/06/2014, 09:49
the development of the asean trade dispute settlement mechanism from diplomacy to legalism koesrianti
Ngày tải lên: 01/07/2014, 01:45
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
Ngày tải lên: 05/09/2013, 09:38
The Comedy Bible: From Stand-up to Sitcom--The Comedy Writer's Ultimate "How To" Guide
... Going into a Story A lot of my workshop students really want to put a "this really hap- pened" story into their act. They make up a premise to give them an excuse to tell the story. ... not enough; they wanted to see the video of his stand -up showcase. And if you look at the staff of the top TV sitcoms, most of the writers and pro- ducers started by doing stand -up. PRO TALK ... but ii is the most important pan. If you can't get the audience interested at the beginning of a joke, they are not going to be there at the end of the joke. Audiences make up their minds...
Ngày tải lên: 22/02/2014, 21:34
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... constant amounts of SenR and increasing amounts of unlabeled up- hbpS verified the specificity of the SenR up- hbpS1 interaction (Fig. 5C, third box from left). Taken together, these data revealed ... GACGGAATTCAGGATCGGTTCCGG (located upstream of hbpS and ending at the 5 ¢-end of the inverted repeat) H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS and beginning at the 3¢-end of the inverted repeat) IIPstrev ... described for other known regulators. Depending on the physiologic condition, either the activator NhaR or the RR RcsB from E. coli interacts with overlapping motifs within the upstream region of osmC....
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Assignment of the [4Fe-4S] clusters of Ech hydrogenase from Methanosarcina barkeri to individual subunits via the characterization of site-directed mutants pdf
... [20]. The mid- point potentials of these clusters are pH independent. Hence, the properties of the iron–sulfur clusters present in the catalytic core of complex I seem to differ from those of the ... the purity of the enzyme from these mutants was lower than the enzyme isolated from the EchF2, EchF6 and EchF8 mutants. Hydrogenase activity of the purified enzymes was determined by the H 2 -uptake ... 15 K a twofold splitting of the Ni a –L signal was observed due to the interaction of the Ni-based unpaired electron with the S ¼ ½ system of the reduced proximal [4Fe-4S] cluster. The temperature dependence...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf
... Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA Andrey Kropotov 1,2,3 , Vladimir ... normal level of expression of the PRDX5 gene (see above). Figure 5A (left bars) shows the results of analysis of 8-oxoG in the control and KD-1 cells. In the KD-1 cells, the concentration of endogenous ... processing and formation of siRNA. We compared cDNAs synthesized using random pri- mer on total RNAs from the PRDX5 KD-1 clone and from the control clone. The sequences of primers used in real-time...
Ngày tải lên: 30/03/2014, 11:20
Guattari’s Aesthetic Paradigm: From the Folding of the Finite/Infinite Relation to Schizoanalytic Metamodelisation docx
... system, the symptom offers an escape route from the impasses of the present, or, simply, belies the very presence of the infinite within the finite. However, as we have seen, the rupturing of given ... machine’, ‘working toward the assemblage of the verbal self – in symbiosis with the other assemblages of the emergent self – and thereby inaugurating a new mastery of the object, of touch, of a spatiality. ... singular characteristics of the assemblage of enunciation fall into the trap of the Signifier’ (74). Schizoanalysis, on the other hand, will attend to the asignifying semiotics of the game that have...
Ngày tải lên: 30/03/2014, 11:20
the cambridge history of russia - i - from early russia to 1689
... perrie They owed their victory largely to the backingof the khans, and also to support from the leaders of the Orthodox Church. In fifteenth-century Muscovy there was a shift from collateral to linear (vertical) ... the ‘Normanists’ and their opponents concerning the role of the Vikings in the formation of the early Rus’ state, seem to have run into the sand. Psychiatrised explanations of the behaviour of ... Insti- tute of Mediaeval Studies, Toronto, and Professor of Medieval History, University of Toronto. He is the author of Mikhail, Prince of Chernigov and Grand Prince of Kiev, 1224–1246 (1981), The Dynasty...
Ngày tải lên: 17/04/2014, 15:33
Effects of Minimum Drinking Age Laws Review and Analyses of the Literature from 1960 to 2000
Ngày tải lên: 02/06/2014, 09:38
the anti-intellectual presidency the decline of presidential rhetoric from george washington to george w bush jun 2008
Ngày tải lên: 10/06/2014, 21:26
practical markers of the transition from aerobic to anaerobic metabolism during exercise
Ngày tải lên: 12/06/2014, 11:18
210. The change from day to night results the rotation of the Earth. a. change b. to c. results d. potx
Ngày tải lên: 18/06/2014, 17:20
MEASURING SAFETY CULTURE IN THE AUSTRALIAN REGIONAL AIRLINE INDUSTRY: THE DEVELOPMENT OF THE AIRLINE SAFETY CULTURE INDEX
... vào các ngày nghỉ theo quy định thì được thanh to n tiền lương theo đúng tỷ lệ của pháp luật lao động. Khi có công việc phát sinh mà Công ty đòi hỏi nhân viên làm việc thì tùy theo mức độ phức ... viên. Sau khi tính lương xong nộp cho Kế to n trưởng kiểm tra và đối chiếu và trình giám đốc ký duyệt bảng tổng hợp ngày công và bảng thanh to n lương. Kế to n trưởng viết phiếu chi và trình giám đốc ... viên. Theo dõi tình hình biến động lao động và tiền lương của cán bộ nhân viên. Theo dõi và khiếu nại với cơ quan Nhà nước có thẩm quyền khi cơ quan BHXH vi phạm điều lệ BHXH. Thực hiện và theo...
Ngày tải lên: 19/04/2013, 23:00
DEVELOPMENT OF THE OZONIZER AND OZONATION TECHNOLOGY FOR WATERWORKS IN JAPAN
Ngày tải lên: 05/09/2013, 08:40
Developmentof the Microfinance system in Russia
... proceeds; to create a credit history for the further development of SMEs through the bank sector; to barrier SMEs for their transition to the shady sector of economics. Small business development ... resources from financial institutions SMEs meet depositors directly Main tasks of Microfinance to stimulate efficiency access to the financial resources; to create work places; to grow of tax ... flexible form of a classical banking credit • permit to set up the business without start -up capital and credit history Why not a bank? • lack of guarantees; • lack of credit history; • necessity...
Ngày tải lên: 24/10/2013, 03:15
Tài liệu User Interface Design: Bridging the Gap from User Requirements to Design doc
... the blue sticky of that task object into the client area of a window (bottom right of Figure 2.1). By the end of this second day only eight of the original task objects remain on the table, the ... tasks and the facilitators that are present to assist them to accomplish their goals. The information gathered from users is then merged with the marketing information to form a set of prioritized ... side of the gap, the Delta method begins with a system definition where the goal is to set the scope of the project and to gather some preliminary customer requirements. The next phase consists of...
Ngày tải lên: 16/01/2014, 16:33
Bạn có muốn tìm thêm với từ khóa: