Franchising as a modern contractual realization of distribution (Particularly in Slovakia)
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...
Ngày tải lên: 06/03/2014, 22:21
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... expression of β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR ... immunohistochemical staining In contrast, PSA was stained in both prostate cancer tissue and non-cancerous tissue (Figure 2C) These data indicated that AMACR h...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo y học: " Laugh syncope as a rare sub-type of the situational syncopes: a case report" potx
... conclusion Laugh syncope was diagnosed in the patient based on his characteristic presentation Situational syncopes such as laugh syncope are usually diagnosed using history from the patient [9] In the ... neurologic syncope were associated with an increased risk of death from any cause and an increased risk of cardiovascular events and stroke, respectively [15] By com...
Ngày tải lên: 11/08/2014, 21:22
báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx
... The association of Fanconi' s anemia and squamous cell carcinoma Cancer 1983, 52:926-928 Kennedy AW, Hart WR: Multiple squamous- cell carcinomas in Fanconi' s anemia Cancer 1982, 50:811-814 Alter ... Buchwald M: Fanconi anemia revisited: old ideas and new advances Stem Cells 1994, 12:142-153 Linares M, Pastor E, Gomez A, Grau E: Hepatocellular carcinoma and squamous...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
... change in mPAP or PVR during exercise with breathing of oxygen as a parameter of pulmonary vascular remodeling Change in mPAP was significantly correlated with VEGF level in induced sputum from bronchitis-type ... evaluation of degree of pulmonary vascular remodeling in bronchitis-type patients Using both pulmonary hemodynamic study and histological...
Ngày tải lên: 12/08/2014, 15:20
Property rights as investment incentives the contractual structure of rd activities in biopharmaceutical industry
... unified account of the costs and the benefits of integration In the PRT, integrating asset 25 ownership changes incentives, but does not result in coordinated investments as in the TCE Therefore, ... bargaining power of trading partners may have a profound impact on the allocation of property rights In the biopharmaceutical industry, financial constraints...
Ngày tải lên: 11/09/2015, 16:05
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic a...
Ngày tải lên: 16/09/2015, 17:10
A Plasmonic Photocatalyst Consisting of Silver NanoparticlesEmbedded in Titanium Dioxide
... a fourth approach, namely plasmonic photocatalysis The idea of plasmonic photocatalysis is as follows TiO2 of anatase phase is a semiconductor with a band gap of 3.26 eV,12 so near UV irradiation ... photocatalysis Similar ideas were already outlined in the past.14,15 For example the photoinduced charging and dark discharging of a silver core as a means to modulate t...
Ngày tải lên: 18/09/2013, 21:27
A STUDY ON TRANSLATION OF DELIVERY TERMS IN INTERNATIONAL BUSINESS CONTRACTS
... 1999) Chapter three: A STUDY ON THE TRANSLATION OF DELIVERY TERMS IN INTERNATIONAL BUSINESS CONTRACTS Translation of some authentic international business contracts The general knowledge about terms ... knowledge in native language as well as foreign languages Finally, I am also interested in translation skill, especially in translation of terms...
Ngày tải lên: 11/12/2013, 23:55
A study on translation of expression used in some vietnamese dishes into english
... Word-for-word translation 2.3 Literal translation 2.4 Faithful translation 2.5 Semantic translation 2.6 Adaptation translation 2.7 Idiomatic translation 2.8 Communicative translation 2.9 Other translations ... Modulation 5.6 Total syntagmatic changeAdaptation Chapter two: Translation of some popular Vietnamese dishes into English General introduction of popular...
Ngày tải lên: 11/12/2013, 23:55
A study on translation of related terms in industrial paint from english into vietnamese
... methods and equivalences in general and translation of ESP as well as technical translation in detail Chapter is an investigation on translation of related terms in Industrial paint from English into ... and ESP translation Chapter is an investigation on translation of terms related so Industrial paint from English into Vietnamese with t...
Ngày tải lên: 11/12/2013, 23:55
A cross cultural study of addressing form in greetings in vietnamese and english
... burial of the dead; a gesture, such as a handshake or an idea, such as democracy Following this understanding, cultural trait may be an act, such as greeting And addressing forms in greetings also ... basic forms of address in English greetings 2.3 Addressing Forms in Greetings in Vietnamese and English 2.3.1 Addressing Forms 2.3.1.1 In Vietnamese...
Ngày tải lên: 14/12/2013, 00:40
A cross cultural study of using hedges in refusing a request in english and vietnamese
... CHAPTER II ENGLISH AND VIETNAMESE IDIOMS USING NAMES OF ANIMALS 2.1 English and Vietnamese Idioms Using Names of Animals 2.1.1 The Names of Animals in English Idioms 2.1.2 The Names of Animals ... Pedagogical Suggestions for Teaching English Idioms Teaching and learning a language are teaching and learning a culture Language and culture can not be separ...
Ngày tải lên: 14/12/2013, 00:41
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...
Ngày tải lên: 18/02/2014, 18:20
A study on polysemy of antonymous words in English Some related problems facing learners of English and suggested solutions
... cases of maintain, melt and take 2.1 Antonyms of maintain Maintain is a polysemantic word, because, it has related senses and one of sense has an antonym, which is analysed in the following examples ... these adverbs are antonymous adverbs (Outside and inside are adverbs and they are antonyms in terms of the contractory direction, carefully and carelessly are adver...
Ngày tải lên: 21/03/2014, 09:17