Accounting for SMEs and suitability of IFRS for SMEs in Macedonia
Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx
... by their friends and relatives The men’s social support increased over time for all types of support from all sources The women’s social support increased over time for all types of support from ... result in the loss of support In fact, although the number of reported social ties decreased over time, the amount of emotional and instrumental su...
Ngày tải lên: 06/03/2014, 15:20
ACCOUNTING FOR CHANGES IN BIODIVERSITY AND ECOSYSTEM SERVICES FROM A BUSINESS PERSPECTIVE potx
... ‘true’ and ‘fair’ information about the actual economic performance of the company Therefore, financial accounting and reporting are being dealt with in national laws and international accounting ... Conventional environmental financial accounting falls within the framework of modern accrual accounting and its associated financial reports It deals with differentiating financ...
Ngày tải lên: 15/03/2014, 22:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx
... necessary for the training of field veterinarians This workshop information and the lectures were used to run workshops for the field veterinarians in the South and Centre of Vietnam and this information ... improve the diagnostic capability of the Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 3 " pptx
... provided and are continuing to provide support and training to other laboratories in the network The project has highlighted the need for training of field veterinarians in the collection of data and ... diagnosis and control of FMD by the provision of resources and training of staff in required methods and quality assurance To provide accurate data...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 6 " ppt
... Australia and internationally through the training programs and also through the achievements in understanding FMD in Vietnam FMD is a disease of importance in Vietnam and the region and this ... is important for matching of antigen between the ELISA and the field strain (and with knowledge of the antigen used in the vaccine) It appears that the se...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of Improved Capability in Support of National Biosecurity for the upport Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 8" pptx
... start of the project, on-going OIE workshops and highly effective on -the- job “hands-on” training of DAH personnel in the field during the course of the project The successful reduction of FMD in ... understanding of the incidence of specific serotypes in circulation in the field in Vietnam, the determination of the efficacy of vaccine coverage...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " ppt
... publicity in Vietnam, Australia and internationally and recognition of the achievements made in relation to the understanding and control of FMD in Vietnam FMD is a disease of importance in Vietnam and ... detailed in the earlier Milestone Report • Standard forms and protocols for collection of field data and trained field veterinarians in how to ca...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 5 " ppt
... improve the diagnostic capability of the Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control This will strengthen the profile of DAH which ... Determine the efficacy of the FMD vaccine in protecting against FMD isolates circulating in Vietnam Comparison of FMD genotypes to vaccine Results of se...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestones 7 " docx
... Chi Minh City continued to train and support the field veterinarians on how to collect samples and how to collect information necessary for the history of the animals for the villages in the project ... primary animal handlers and managers, they will be major beneficiaries of the final outcome of better diagnosis and control of animal diseases Implementat...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo khoa học: "Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture" potx
... accordance of all but points seem quite acceptable APPLICATIONS TO SIMULATION Mitchell (1975a) gave a detailed diagram of the processes involved in the growth and development of a tree in a stand ,and Inose ... for Tree and Stand Simulation (Fries J, eds) Dept For Yield Res, R Coll For, Stockholm, Res Notes 30, 223-239 Hegyi (1974) A simulation model for mana...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo sinh học: "Support for single major genes influencing fat androstenone level and development of bulbo-urethral glands in young boars MN Fouilloux" potx
... results of this study The finding of a major gene affecting fat androstenone level gives rise to new prospects for reducing incidence of boar taint by means of breeding The average level of individuals ... FJ35 and FJ39) For investigating the linkage of SLA with the postulated major genes, the number of informative meioses was 441 typing was performed Statisti...
Ngày tải lên: 09/08/2014, 18:22
Báo cáo y học: " Perioperative infusion of low- dose of vasopressin for prevention and management of vasodilatory vasoplegic syndrome in patients undergoing coronary artery bypass grafting-A double-blind" potx
... al.: Perioperative infusion of lowdose of vasopressin for prevention and management of vasodilatory vasoplegic syndrome in patients undergoing coronary artery bypass grafting-A double-blind randomized ... in the vasopressin actions Conclusions In summary, infusion of an “ultra-low” dose vasopressin (0.03 U/min) during cardiopulmonary bypa...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... what and how of measuring baseline performance defined as the measurement of actual clinical practice and its comparison to desired clinical practice (Measuring Baseline Performance) NorthStar ... evidence-based clinical practice NorthStar is a major product of the ReBEQI project It is a software program that packages information on the design and evaluation of evi...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.)" pptx
... frequency and distribution of SSRs in castor bean ESTs, (2) the establishment and validation of EST- SSR markers for detection of polymorphism in castor bean, and (3) the assessment of genetic ... an increasing need for distinguishing the varieties reliably, establishing their purity, and fingerprinting released varieties, hybrids and the parental l...
Ngày tải lên: 11/08/2014, 11:21