... negative charges fall toward the GaAs side but are attracted by the positive charges that remain on the AlGaAs side This results in the bands bending and confining the charge at the “perfect” AlGaAs-GaAs ... twodimensional atomic layers of atoms These are among the thinnest objects imaginable The strongest bond in nature, the C-C bond covalently locks these atoms in...
Ngày tải lên: 24/03/2014, 05:20
A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Master of Environmental Studies in Environment and Resource Studies
... Some cracks in the theory – the example of exergy and waste impact A second argument for re-examining the underlying theory connecting exergy and resource value is that there are already cracks appearing in application of exergy ... destruction of a resource is a measure of the amount by which the value of the resource is consumed, and the exergy of a...
Ngày tải lên: 10/12/2016, 13:37
... and analysis By placing students in a market situation and asking them to interpret their behavior and observations and to analyze the market results, they are able to move from abstraction to ... email addresses I then contacted these social studies teachers and explained the purpose of my research project and asked them how many years they had been teaching, how many yea...
Ngày tải lên: 17/03/2014, 06:20
A Pragmatic Introduction to the Art of Electrical Engineering
Ngày tải lên: 04/11/2013, 10:15
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... advantage of the top-down approach is that a final separation stage can be done in the FT MS instrument For example, after rough separation of the proteins from Arabidopsis thaliana, the stromal ... dissociation spectral data, YjbV fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... algorithm to the context vectors, we should obtain the two expected clusters Each of the two clusters corresponds to one of the senses of palm, and the words closest to the geometric centers of the ... strength to the ambiguous word, in each matrix we removed all words that are not among the top 30 first order associations to the ambiguous word These t...
Ngày tải lên: 20/02/2014, 16:20
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot
... /21.67 total amount due Fundamentals of NGO Management Sick Annual Taken Annual leave days remaining 47 Fundamentals of NGO Management Annex 20: Honoraria agreement Name of organisation: An ... previous financial year • records of statutory payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of a...
Ngày tải lên: 06/03/2014, 21:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... word from the centroid of its closest cluster, and to assign the differential vector to the most appropriate other cluster This process can be repeated until the length of the differential vector ... (2004) Toward unsupervised wholecorpus tagging Proceedings of COLING, Geneva, 357-363 Rapp, Reinhard (2004) A practical solution to the problem of automatic wo...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides...
Ngày tải lên: 08/03/2014, 08:20
A further contribution to the study of the mortuary customs of the North American Indians docx
... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last ye...
Ngày tải lên: 08/03/2014, 13:20
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
... found in the list of pseudo-roots In that case, the transliteration subroutine dictates the form of the correspondent to be stored in the normal position of the target T for the final printout A ... signal is stored in GS and the tag t is placed in the normal position of the target T for final printout ILLUSTRATION As an example of the performance of this s...
Ngày tải lên: 16/03/2014, 19:20