0

a practical solution to the problem of asphaltene deposits

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

Báo cáo khoa học

... judgment, all words in the upper branch of the hierarchical tree are related to the hand sense of palm, and all other words are related to its tree sense. However, it is somewhat unsatis-factory ... vectors. To see this, let us bring our attention to the various species of ani-mals that are among the top 30 associations to poach. Some of them seem more often affected by cooking (pheasant, ... In an attempt to provide a quantitative evaluation of our results, for each of the 12 ambiguous words shown in table 1 we manually assigned the top 30 first-order associations to one of the...
  • 4
  • 536
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

Báo cáo khoa học

... vector comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate alge-braic method that has the capability to reduce ... salient. Also, widely and rural are well within the adjective cluster. The comparison of the two dendrograms indicates that the SVD was capable of making ap-propriate generalizations. Also, when ... number of rows to a vocabulary appropriate for evaluation purposes. Since we are not aware of any standard vocabulary previously used in related work, we manually selected an ad hoc list of 50...
  • 4
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated...
  • 8
  • 522
  • 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Kế toán - Kiểm toán

... N$SUB-TOTALPAYMENTSSUB-TOTALBALANCE END OF PERIOD Fundamentals of NGO ManagementTheunis Keulder & Erika Benz A Practical Guide to the Financial Management of NGOs Published by Namibia ... Introduction to financial managementLeaders and managers of NGOs have to develop, at the very least, basic skills in financial management. Expecting others in the organisation to manage finances is clearly ... understanding of the financial condition of the organisation. Financial analysis shows the ‘reality’ of the situation of an organisation – and as such, is one of the most important practices in management....
  • 76
  • 576
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A general solution to the continuous-time estimation problem under widely linear processing" pdf

Hóa học - Dầu khí

... (this approximate expansion explains 99.86% of the total variance of the process). The performance of both the SL and the WL estimators for n =10doesnotreally vary substantially from the case of ... asgreat as the SL estimator.Notice also that the Hilbert space approach we havefollowed to derive the WL estimators allows us to givean alternative proof of the well-known fact that WLestimation ... linearprocessingAna Mar a Martínez-Rodríguez, Jesús Navarro-Moreno, Rosa Mar a Fernández-Alcalá*and Juan Carlos Ruiz-MolinaAbstract A general problem of continuous-time linear mean-square...
  • 11
  • 489
  • 0
Báo cáo y học:

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Báo cáo khoa học

... AAhmet@cheo.on.ca1University of Ottawa, Children’s Hospital of Eastern Ontario, Ottawa, Ontario,CanadaFull list of author information is available at the end of the articleAhmet et al. Allergy, Asthma & Clinical ... (ICSs) are the most effectiveanti-inflammatory medications available for the treat-ment of asthma and represent the mainstay of therapyfor most patients with the disease. The current Cana-dian ... management of asthma over the past decade, as wellas the availability of comprehensive and widely-acceptednational and international clinical practice guidelines forthedisease[6,7],asthmacontrolinCanadaremainssuboptimal....
  • 12
  • 774
  • 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Sức khỏe trẻ em

... Paspalaki, Katakis, & Evangeliou, 2003). The risk of cancer decreases to the same as a person without CD after a GFD has been followed for 3 to 5 years (Coeliac UK, 2007). In addition to ... protocol by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available ... 39-year old man suffering with anxiety as a result of residual psychotic symptoms. Clinical Practice Report 5 was an oral presentation of a piece of clinical work completed with staff at a day...
  • 171
  • 709
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... MR-1R was used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation of high...
  • 11
  • 731
  • 0
A further contribution to the study of the mortuary customs of the North American Indians docx

A further contribution to the study of the mortuary customs of the North American Indians docx

Khoa học xã hội

... Kagamale, the island in question, as the last resting-place of a great chief, knownas Karkhayahouchak. Last year the captain was in the neighborhood of Kagamale in quest of sea-otter andother ... brought and placed around the feet and legs of the horse, andgradually laid up to its sides, and at last over the back and head of the unsuspecting animal, and last of all over the head and even the ... hair are attached as a trophy. The bow, arrows, assagai, and clubs of the deceased are hung on the same post. Large stones are pressed into the soil above and around the grave, and a large pile of...
  • 108
  • 604
  • 0
A PRACTICAL ENQUIRY INTO THE PHILOSOPHY OF EDUCATION ppt

A PRACTICAL ENQUIRY INTO THE PHILOSOPHY OF EDUCATION ppt

Cao đẳng - Đại học

... method of investigating Nature, almost always proceeds upwards, analytically, advancing from the general to the special, from the aggregate to its parts, endeavouring to ascertain as trace the ... perceive and reiterate the ideas while reading, acquire the A PRACTICAL ENQUIRY INTO THE PHILOSOPHY OF EDUCATION. BY JAMES GALL, INVENTOR OF THE TRIANGULAR ALPHABET FOR THE BLIND; AND AUTHOR ... several operations of the physician, the surgeon, and the dentist; in the same way as the investigations of the Educationist are intended to direct the operations of the Teacher. Now the mode of...
  • 287
  • 433
  • 0

Xem thêm

Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008