Magnetic, electronic, and structural characterization of

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...

Ngày tải lên: 18/02/2014, 17:20

... analysis of the PAH gene in 51 unrelated HPA patients from Southern Italy In addition to the molecular epidemiology of PAH mutations, we characterized the functional properties of two novel mutations ... phenylalanine hydroxylase deciency in Southern Italy: a 96% detection rate with ten novel mutations Ann Hum Genet 71, 1 8519 3 10 Waters PJ (2003) How PA...

Ngày tải lên: 16/03/2014, 01:20

... the hydrothermal conditions are: x # 0:2 for Sn4þ in the a-Fe2O3 and x $ 0:7 for Fe3þ in SnO2 This paper is the first report on the hydrothermal synthesis and structural characterization of (1 ... with coordinates of ð0; 0; zÞ occupy 2/3 of the octahedral holes in successive oxygen layers, and 1/3 of the octahedral holes with coordinates of ð0; 0; 0Þ are empty In the...

Ngày tải lên: 19/03/2014, 16:48

... inosine and guanosine This paper describes the cloning, recombinant expression and structural and functional characterization of purine nucleoside phosphorylase from the hyperthermophilic archaeon ... with the native state of the protein We then carried out the characterization of the thermal properties of the mutant in comparison with those of Pf...

Ngày tải lên: 23/03/2014, 09:21

... complimentary mutagenic primers (IDS1 2A, 5¢CGATGGAAGAAGGTGCTGAGAATTCGAAGC-3¢ and IDS12B, 5¢-GCTTCGAATTCTCAGCACCTTCTTCCA TCG-3¢) were synthesized and purified by MWG-Biotech AG (Ebersberg, Germany) ... spectropolarimeter (Jasco UK, Great Dunmow, UK) The bandwidth was nm and the scanning speed was 200 nmÆmin)1 with a response time of s and a data pitch of 0.5 nm Typically, 16 sp...

Ngày tải lên: 23/03/2014, 10:21

... for the Ndh membrane subcomplex The Ndh antibodies recognized the 46, 28, 18 and 12 kDa polypeptides, corresponding to the NdhH, -K, -J and -E subunits of the Ndh complex The intact Ndh complex, ... et al of the ndh genes is much higher in BS chloroplasts, and elevated amounts of the Ndh complex have been found in these plastids [18] The functio...

Ngày tải lên: 23/03/2014, 13:20

... treatment with neuraminidase (as indicated by – and +, respectively) The sialylated tetrasaccharide-containing glycoforms are indicated by an asterisk All strains were grown on media containing ... that a terminal Sial-lNnT unit is linked to the Hep I residue of the LPS inner core in the sialylated glycoform The structure of the sialylated glycoforms of the O...

Ngày tải lên: 23/03/2014, 21:21

... Parajuli IDENTIFICATION, KINETIC AND STRUCTURAL CHARACTERIZATION OF SMALL MOLECULE INHIBITORS OF ALDEHYDE DEHYDROGENASE 3A1 (ALDH3A1) AS AN ADJUVANT THERAPY FOR REVERSING CANCER CHEMORESISTANCE ALDH ... reactivity and metabolism Important Aldehyde Dehydrogenase family members ALDH3A1 and its importance in cancer chemoresistance 19 Cyclopho...

Ngày tải lên: 24/08/2014, 09:51

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A...

Ngày tải lên: 19/02/2014, 06:20

... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclud...

Ngày tải lên: 22/02/2014, 07:20

... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c...

Ngày tải lên: 22/02/2014, 07:20

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...

Ngày tải lên: 08/03/2014, 22:20

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...

Ngày tải lên: 16/03/2014, 06:20

... asymptotically the value of the band-gap of the undoped Si-nw This is another indication of how doping can modify the electronic and optical properties of the Si nanostructures Conclusions 3.2 3.4 ... systematic analysis of the effect of the B and P codoping in Si-nw, concentrating not only on the structural properties but also on how doping i...

Ngày tải lên: 16/03/2014, 15:15

... Nlinked oligosaccharides of laminin during diabetes and the likelihood of dietary fiber and butyric acid in modulating these changes Results Rats experimentally induced with diabetes using streptozotocin ... Kumar et al Laminin oligosaccharide changes during diabetes Table Effect of dietary fiber and butyric acid on fasting blood sugar, urine...

Ngày tải lên: 22/03/2014, 17:20