Construction and Characterization of a Fulllength cDNA Library and Identification of Genes Involved in Salinity Stress in Wild Eggplant (Solanum torvum Swartz)

báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf

... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...

Ngày tải lên: 12/08/2014, 03:21

13 329 0
Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb...

Ngày tải lên: 03/10/2015, 21:58

116 492 0
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot

Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot

... investigating the relation, differentiation and/ or maturation of monocytes, macrophages and DC have been mainly conducted in vitro using both murine and human cells [33-35] A study comparing primary ... purity of sorted cells used for the microarray experiments (PBMo, lung DC and lung Mϕ) was assessed by flow cytometry and Pappenheim-stained cytospins and w...

Ngày tải lên: 12/08/2014, 14:20

16 320 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

8 703 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... identification and quantification of puromycin were achieved by a Pac enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 ... Schematic representation of the putative biosynthetic pathway of the 3¢-amino-3¢deoxyadenosine moiety of A2 0 1A and puromycin Dpur4 mutants The results indica...

Ngày tải lên: 21/02/2014, 01:21

9 728 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and pro...

Ngày tải lên: 07/03/2014, 03:20

12 561 0
Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells

Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells

... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in...

Ngày tải lên: 30/09/2015, 06:36

257 293 0
the regulation of genes involved in trichome development

the regulation of genes involved in trichome development

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in...

Ngày tải lên: 14/11/2014, 11:55

186 167 0
the regulation of genes involved in trichome development(fileminimizer)

the regulation of genes involved in trichome development(fileminimizer)

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in th...

Ngày tải lên: 14/11/2014, 12:16

186 210 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... conceived of the work and participated in its design and coordination CS and MR made substantial contributions to data acquisation and conception of manuscr...

Ngày tải lên: 11/08/2014, 20:21

5 574 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and...

Ngày tải lên: 16/03/2014, 13:20

12 460 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

... detectable in the cell wall-free mutant These findings stand in contrast to a subsequent analysis of singlegene knockout data indicating that E coli can only survive if at least L1-P-EtAmine and a lipid ... synthesis of unsaturated and saturated fatty acids, phospholipids (including cardiolipin), and lipid A It is important to study the metabolism of the glucosa...

Ngày tải lên: 22/03/2014, 21:20

12 554 0
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] su...

Ngày tải lên: 22/03/2014, 21:21

12 463 0
w