Construction and Characterization of a Fulllength cDNA Library and Identification of Genes Involved in Salinity Stress in Wild Eggplant (Solanum torvum Swartz)

Ngày tải lên: 11/11/2016, 15:59

... and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, TTCCAAGTTCTTGTGGGAGGAG, GACTGATTTTCTCTCCACCAAGCAAG) Sequence analysis Repetitive DNA was identified with the RepeatMasker software ... on the BAC scaffolds of PGB02 (3CAR) (ACCCATCTTCACAAAATTAC, GTAGTCCATAACGAGCAGAA) and PGB04 (CYP720B4) (TGATATTTGGTCTGCCATGGGCG, CATTTCCCTGCATGTATTCAATGCC, CCACCACATAGTTAGACCGTGATGC) Auth...

Ngày tải lên: 12/08/2014, 03:21

... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb...

Ngày tải lên: 03/10/2015, 21:58

... investigating the relation, differentiation and/ or maturation of monocytes, macrophages and DC have been mainly conducted in vitro using both murine and human cells [33-35] A study comparing primary ... purity of sorted cells used for the microarray experiments (PBMo, lung DC and lung Mϕ) was assessed by flow cytometry and Pappenheim-stained cytospins and w...

Ngày tải lên: 12/08/2014, 14:20

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

... identification and quantification of puromycin were achieved by a Pac enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 ... Schematic representation of the putative biosynthetic pathway of the 3¢-amino-3¢deoxyadenosine moiety of A2 0 1A and puromycin Dpur4 mutants The results indica...

Ngày tải lên: 21/02/2014, 01:21

... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and pro...

Ngày tải lên: 07/03/2014, 03:20

... EFFECTS OF HIGH GLUCOSE CONCENTRATIONS ON THE EXPRESSION OF GENES INVOLVED IN PROLIFERATION AND CELL- FATE SPECIFICATION OF MOUSE EMBRYONIC NEURAL STEM CELLS FU JIANG (MD, MMed) A THESIS ... Illustration Schematic summary of the effects of high glucose on the expression of developmental control genes that are involved in...

Ngày tải lên: 30/09/2015, 06:36

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in...

Ngày tải lên: 14/11/2014, 11:55

... redundant inhibitors of trichome initiation The key to understanding the process by which a cell adopts the trichome fate lies not only in finding the components of the initiation and inhibitory ... preferentially with the bHLH dimer, preventing expression of genes involved in trichome development TTG would act in the cytoplasm most probably aiding in th...

Ngày tải lên: 14/11/2014, 12:16

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... conceived of the work and participated in its design and coordination CS and MR made substantial contributions to data acquisation and conception of manuscr...

Ngày tải lên: 11/08/2014, 20:21

... in the HD -caveolae and LD -caveolae; (c) the VHD -caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin is found in the plasma membrane of adipocytes; ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and...

Ngày tải lên: 16/03/2014, 13:20

... detectable in the cell wall-free mutant These findings stand in contrast to a subsequent analysis of singlegene knockout data indicating that E coli can only survive if at least L1-P-EtAmine and a lipid ... synthesis of unsaturated and saturated fatty acids, phospholipids (including cardiolipin), and lipid A It is important to study the metabolism of the glucosa...

Ngày tải lên: 22/03/2014, 21:20

... as important catalytic residues, indicating a role in binding the nucleotide into the active site [15,16] The crystal structure of CNS from Neisseria meningitidis crystallized in the presence of ... stereo-view of the residues of interest (blue) in the active site of the CNS from Neisseria meningitidis containing CDP (yellow) (PDB 1EYR) [12] su...

Ngày tải lên: 22/03/2014, 21:21