Analysis of primary presidential preference votes in 5 states shows problems in the absentee ballots

... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding r...

Ngày tải lên: 07/03/2014, 02:20

... Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations Journal of Operations and Supply Chain Management ... Costa, Francisco J., Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Pro...

Ngày tải lên: 23/03/2014, 05:22

... al.: Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor ... resulted in finding a total of 42 genes common to both (Additional file 10) In order to begin to understand the signif...

Ngày tải lên: 20/06/2014, 07:20

... daily at the time of analysis After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histological examination After approval by the ... typically present in sera of patients with SS [18] and was also detected in the saliva or in salivary gland biopsies [19] of these patients In this regard, Mart...

Ngày tải lên: 09/08/2014, 03:24

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên: 11/08/2014, 11:21

... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coor...

Ngày tải lên: 12/08/2014, 02:20

... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6...

Ngày tải lên: 13/08/2014, 01:20

... comparisons, analysis of these regions indicates a noticeable reduction in the rate of recombination in regions containing a high density of repetitive DNA, supporting our hypothesis that these regions ... Density distribution of repetitive DNA on each chromosome of T castaneum Density and distribution of repetitive DNA on each chromosome of T castaneum...

Ngày tải lên: 14/08/2014, 08:21

... Role of Superoxide anion in Cancer 55 PROSTATE CANCER 1. 6 .1 1.6.2 1. 6.3 AIM OF STUDY MATERIALS 2 .1. 1 2 .1. 2 2 .1. 3 2 .1. 4 2.2 GROWTH-FACTOR REGULATION OF CELL SURVIVAL 3 .1. 1 3 .1. 2 3 .1. 3 3 .1. 4 3 .1. 5 ... Bad-dependent 11 6 RSK1 is the Bad kinase activated by EGF in LNCaP cells 12 1 iv 3 .1. 8 3 .1. 9 3 .1. 10 3.2 Role of ErbB receptors in EGF- an...

Ngày tải lên: 12/09/2015, 08:18

... SERUM-MEDIATED SURVIVAL IS INDEPENDENT OF MEKERK- AND PI3K-AKT -INDEPENDENT PATHWAY IN LNCAP CELLS Although both EGF and serum inhibited LY-induced apoptosis in LNCaP cells, analysis of survival signaling involved ... PI3K-AKT -INDEPENDENT SURVIVAL PATHWAY(S) IN LNCAP CELLS The PI3K-Akt pathway has been proposed to be the major survival pathway in LNCaP cells due...

Ngày tải lên: 12/09/2015, 08:18

... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5...

Ngày tải lên: 26/11/2015, 12:46

... scope of using primary imperative sentences in English and that in Vietnamese; To suggest some practical applications about primary imperative sentences in English and those in Vietnamese Scope of ... Contrastive analysis of primary imperative sentences in English and those in Vietnamese Structure of the primary imperative sentences A...

Ngày tải lên: 12/12/2013, 00:03

... quetiapine, and aripiprazole groups Discussion In this post-hoc analysis of randomized, double-blind trials of olanzapine versus other atypical antipsychotics, patients treated with olanzapine ... H, Taylor CC, Dunayevich E, Davis JM: All-cause treatment discontinuation in schizophrenia during treatment with olanzapine relative to other antipsychotics: an integrated...

Ngày tải lên: 11/08/2014, 16:23

... freedom for the assignment of the variables under consideration The assignment of the main variables (A, B, C and D), two-variable interaction, and the level setting values of the main variables ... optimization of the MAE conditions To apply these techniques in practical applications, in this chapter I 138 demonstrated the application of these techniques...

Ngày tải lên: 16/09/2015, 17:13

... of Water and Environment Technology, Vol.2, No.2, 2004 Therefore, we investigated successional development of nitrifying bacterial community structure and in situ nitrifying activities in biofilms ... distributions of in situ nitrifying activities were determined The relationship between the spatial organization of nitrifying bacterial populations and the...

Ngày tải lên: 05/09/2013, 08:40