analysis of a differential fluid element in laminar flow

... collaboration We also thank Hans Aniansson for carrying out the neuropsychological examinations, Sara and Lisa Broeren for drawing velocity and acceleration profiles and Ragnar Pascher for programming ... sessions and All participants were tested between 10 AM and PM All tests were performed with the right hand Data analysis Kinematic data sampling and information processing Hand position data (haptic ... straight line distance required to obtain a hand path ratio (HPR) Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory...

Ngày tải lên: 19/06/2014, 10:20

... collaboration We also thank Hans Aniansson for carrying out the neuropsychological examinations, Sara and Lisa Broeren for drawing velocity and acceleration profiles and Ragnar Pascher for programming ... sessions and All participants were tested between 10 AM and PM All tests were performed with the right hand Data analysis Kinematic data sampling and information processing Hand position data (haptic ... straight line distance required to obtain a hand path ratio (HPR) Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory...

Ngày tải lên: 11/08/2014, 14:20

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... parameters defined in Tables and in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy project located ... prices are updated yearly by the inflation rate considered in the analysis Table 14 Comparison in absolute values of calculated parameters in the scenarios Mean values in € of the calculated parameters...

Ngày tải lên: 05/09/2013, 14:59

... student in Thermal Engineering from NIT, Silchar, working under the guidance of Prof Rajat Gupta His area of interest is in the field of fluid dynamics and its application, wind energy E-mail address: ... Experimental investigation of the characteristics of a Savonius wind turbine, Journal of Wind Engineering, Vol 29 issue pp 77-82, 2005 [10] Biswas A, Gupta R, Sharma K K, Experimental Investigation of ... Esfahanian, V., D.S-K, Ting., & Fartaj, A. : Applications of Vertical Axis Wind Turbines for Remote Areas In: Proceedings of 5th Iran National Energy Conference, Tehran, Iran, Spring 2005 [4] Bach...

Ngày tải lên: 05/09/2013, 15:28

... contaminant transport in a coupled fracture matrix system E-mail address: itsrajan2002@yahoo.co .in G Suresh Kumar is an Assistant Professor in the Department of Civil Engineering, Indian Institute of Technology ... research interests include numerical modeling of flow and transport processes in a fractured formation He has published 10 research papers in International Journals E-mail address: gskumar@iitm.ac .in ... – Madras, Chennai – 36 He has secured his Doctoral degree from Indian Institute of Science, Bangalore, India He pursued his Post-Doctoral works at US and Canada, before joining at IIT-Madras...

Ngày tải lên: 05/09/2013, 17:03

... metaphor may start out as an explanatory device and facilitate understanding of complex and abstract issues, but gradually it may get absorbed into peoples way of thinking to such an extent that ... leading financial daily newspapers in Vietnam (Thời báo Kinh tế Việt Nam and Diễn đàn Doanh nghiệp) II.1 Analysis of Central Bank reports The fact that the Minutes of the Bank of England Monetary ... prevalence of nominalisation is also seen as a key characteristic and discussed in great detail by Bahtia (1993, ch.6) in the context of academic discourse in general Hewings, also in Dudley-Evans...

Ngày tải lên: 07/09/2013, 12:58

... meaningful units which may constitute words or parts of words” A morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union of a sound and a meaning and ... suffix can attach to practically any adjective, and apart from 13 adjectival base words we find nouns as in “thingness”, pronouns as in “usness” and frequently phrases as in “all-or-nothing-ness” ... exclusively to female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion...

Ngày tải lên: 14/12/2013, 16:45

... faster than the spontaneous decarboxylation, indicating the presence of an induced decarboxylase in the organism The accumulated pyruvate was mainly hydrolysed to equal amounts of acetate (1H ... the intermediate pyruvate, the main products acetate and formate, as well as the small amount of the by-product lactate Fig 2-Butynedioate metabolic pathway in the isolated P putida strain The ... biochemical characterization of the initial acetylene hydratase is inevitable In case of the other, more common enzymes, which are involved a genomic sequence analysis and a comparison to the genome of...

Ngày tải lên: 08/03/2014, 08:20

... literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 1987; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made with ... Chang Table Plant no Database of all industrial wastewater treatment plants in Taiwan Location of wastewater treatment plant Total Levelg Treatment process Year C.C.I.f Normalized total Operation ... explanatory variables (independent variables) and the explained variable (dependent variable) If Y and x are the set of dependent vari- Figure A1 Fuzzy set of parameter A: A approximates a ables...

Ngày tải lên: 15/03/2014, 23:17

... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... results of morphological analysis by aligning the basic form and pronunciation in the CSJ First, the results of morphological analysis, namely, the morphemes, are transliterated into katakana characters ... reported that the accuracy of automatic word segmentation and POS tagging was 94 points in F-measure (Uchimoto et al., 2002) That is much lower than the accuracy obtained by manual tagging Several problems...

Ngày tải lên: 17/03/2014, 06:20

... (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in the watershed area 17 Suggestion zones for sustainable of watershed ... and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack of an appropriate tool ... GIS and remote sensing has been using in several types of works in both government and private agencies As we know, GIS and remote sensing have an important role in linkage and analysis of such...

Ngày tải lên: 17/03/2014, 11:20

... Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lamin A or C Fragment of lamin A or C ATP binding cassette, subfamily C, member Lamin B1 Nuclear ... lamina in human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing ... prophase, ISP36 staining was partly lost in the interchromatin regions but accumulated in a limited area (Fig 9, panel 5) In prometaphase and metaphase, ISP36 staining was excluded from the interchromatin...

Ngày tải lên: 30/03/2014, 20:20

... speakers have idiosyncratic expressions If our training data consisted of a small number of speakers appearing in both training and testing data, then we will be implicitly modeling speaker differences ... talking to In same-gender conversations, almost perfect accuracy is reached, indicating that the linguistic patterns of the two genders be- Table 3: Classification accuracies in same-gender and ... Literary and Linguistic Computing, 16(3):251–264 E Stamatatos, N Fakotakis, and G Kokkinakis 2000 Automatic text categorization in terms of genre and author Computational Linguistics, 26:471–495 A...

Ngày tải lên: 31/03/2014, 03:20

... are not in the vicinity of a city having a medical university and/or having a high level health care institution This paper concentrates on potential effects of training on the social and professional ... possible in smaller hospitals One of the main benefits of medical students gaining not only academic, but also first-hand practical experience of various specialties during their graduate training ... professional settings In education, the most appropriate arrangement would be the elaboration of a complex and comprehensive system of incentives, containing both financial and nonfinancial incentives...

Ngày tải lên: 18/06/2014, 17:20

... variant amino acids Residues 3, 4, 6, 7, 8, 10, 11, and 13 contain multiple variant amino acids ranging from five to eleven The N-terminal domain contains a total of 79 variant amino acids Of ... domain exhibits a total of 80 variant amino acids and 61 of them are of nonconservative in nature Several laboratories including ours have reported on the importance of residues in the helical ... 1995, 207:297-302 Mahalingam S, Khan SA, Murali R, Jabbar MA, Monken CE, Collman RG, Srinivasan A: Mutagenesis of the putative alpha-helical domain of the Vpr protein of human immunodeficiency...

Ngày tải lên: 20/06/2014, 01:20

... ACGCCAGTTGTTAATTTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATTTAATTAAGTGTGGTAAGTTACTGGTAAGAG Egypt/F/03 H120 M41 39 TGCACTATGTAGTGCTGTTTTGTATGACAGTAGTTCTTACGTGTACTACTATCAAAGTGCCTTCAGACCACCTAATGGTTGGCATTTACATGGGGGTGCTTATGCGGTAGTTAATATTTC ... .G G .A T M41 1201 G C G .A T.T Egypt/F/03 1239 TGAACCGCCAGTTATAACTCAACACAATTATAATAATATTACTTTAAATACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTATTACTAATGTAACCGACTCAGCTGT H120 ... TTCTGCTATGAAAAATGGCCAGTTTTTCTATAATTTAACAGTTAGTGTAGCTAAGTACCCTACTTTTAAATCATTTCAGTGTGTTAATAATTTAACATCCGTATATTTAAATGGTGATCT 399 C T 481 C Egypt/F/03 H120 M41 519 TGTTTACACCTCTAATGAGACCACAGATGTTACATCTGCAGGTGTTTATTTTAAAGCTGGTGGACCTATAACTTATAAAGTTATGAGAGAAGTTAAAGCCCTGGCTTATTTTGTTAATGG...

Ngày tải lên: 20/06/2014, 01:20

... Espin S, Lingard L, Baker GR, Regehr G: Persistence of unsafe practice in everyday work: An exploration of organizational and psychological factors constraining safety in the operating room Qual ... error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more serious breakdowns ... multifactorial However, featuring prominently in some of the analyses include breakdown in communication between surgical team members, absence of verification in the operating theatre and of a verification...

Ngày tải lên: 20/06/2014, 04:20

... Espin S, Lingard L, Baker GR, Regehr G: Persistence of unsafe practice in everyday work: An exploration of organizational and psychological factors constraining safety in the operating room Qual ... error have failed; there is an accident waiting to happen [31] The capacity to defend against the potential for minor mishaps having a cumulative effect and escalating into more serious breakdowns ... multifactorial However, featuring prominently in some of the analyses include breakdown in communication between surgical team members, absence of verification in the operating theatre and of a verification...

Ngày tải lên: 20/06/2014, 07:20

... characterization of panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) ... et al: Biodistribution and planar gamma camera imaging of I-123- and I131-labeled F(ab ‘)(2) and Fab fragments of monoclonal antibody 14C5 in nude mice bearing an A5 49 lung tumor Nuclear Medicine ... contrast, an early clinical imaging study conducted by Delaloye et al [19] compared 123I-labeled Fab and F(ab’)2 fragments of an anti-carcinomembryonic antigen mAb in colorectal carcinoma patients...

Ngày tải lên: 21/06/2014, 02:20

... Performance Analysis of T-GSC in Nakagami Channels 245 ¯ ¯ where βmax = γmax / γ and βth = γth / γ Note that the solution in (5) for Nakagami fading is valid only for integer values of the Nakagami ... Rayleigh fading and Nakagami fading channels can be obtained from works in [15, 16], respectively As an illustration of the evaluation of Pb,T (E) using (2) and (5), we consider the case of Nakagami-m ... each branch’s SNR, γl , is a gamma random variable with pdf given as [1]: BER PERFORMANCE: ANALYTICAL DERIVATION Given L available diversity branches at the receiver, each branch having instantaneous...

Ngày tải lên: 23/06/2014, 00:20