THE LIMIT OF A FUNCTION

... number of differences in the N-terminal domain (located on the matrix side) It is likely that the N-terminal domain is involved in protein protein interactions with other hydrophilic domains of neighboring ... chain was established with succinate and glycerol3-phosphate as substrates Complex II activity was determined after addition of succinate, followed by inhibition b...

Ngày tải lên: 19/02/2014, 16:20

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the Al...

Ngày tải lên: 16/03/2014, 23:20

... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen -quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the funct...

Ngày tải lên: 20/06/2014, 22:20

... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 G L Forti, “Hyers-Ulam stability of functional equations in several variables,” ... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo,...

Ngày tải lên: 22/06/2014, 11:20

... characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization of human ... fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fra...

Ngày tải lên: 16/03/2014, 16:20

... Overview Describe the structure of a network, including the devices and media that are necessary for successful communications Explain the function of protocols in network communications Explain ... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Ar...

Ngày tải lên: 01/04/2014, 12:20

... this article as: Holper et al.: Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless ... execution (as in traditional motor learning), imitation, observation (as in observational learning) and motor imagery Activation of these b...

Ngày tải lên: 19/06/2014, 08:20

... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the ... X-ray Additional material Additional file Examination Schedule 1: fokus(C) examination of the spinal column The table shows the different stages of examination...

Ngày tải lên: 20/06/2014, 00:20

... using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and ... Non-Archimedean stability of the functional equation (1) In this section, using the fixed point alternative approach, we prove the Hyers-U...

Ngày tải lên: 20/06/2014, 22:20

... Stability of Functional Equations in Nonlinear Analysis Springer Optimization and Its Applications Springer, New York (2011) [7] Kannappan, Pl: Functional Equations and Inequalities with Applications ... D: The stability of Cauchy equations in the space of Schwartz distributions J Math Anal Appl 295, 107–114 (2004) [18] Lee, Y-S: Stability of a quadratic functiona...

Ngày tải lên: 21/06/2014, 20:20

... domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of generalized ... 2 Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam st...

Ngày tải lên: 22/06/2014, 02:20

... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Pr...

Ngày tải lên: 22/06/2014, 22:20

... repeats (ANK), a transactivation domain (TAD) and a PEST domain (P) TM, transmembrane domain (b,c) Two models for the roles of Ofut1 in Notch trafficking Each model is illustrated in a schematic ... (green) adapted from [19] The S2 cleavage site is indicated by an arrow The intracellular domain (NICD) contains various elements involved in transcriptional activation:...

Ngày tải lên: 06/08/2014, 18:21

... factor (ATF) binding (CREB/ATF) pathway, while in the cytoplasm the viral transactivators interact with several members of the NF-κB transduction pathway [5,37] Tax1 /Tax2 activation of CREB/ATF ... Results HTLV-2 Tax protein sequence contains a putative NES domain We lately demonstrated that the HTLV-2 Tax protein has an intracellular localization that is different f...

Ngày tải lên: 13/08/2014, 09:21

... Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population Conflict and Health 2010 4:16 Submit your next manuscript ... physical functioning and activity, participation in social life and environmental factors was obtained in further interviews u...

Ngày tải lên: 13/08/2014, 14:20