... palms facing downwards, and faced the monitor at a distance of approximately 70 cm The image on the monitor showed a virtual arm in the same orientation and relative position as the real arms, ... http://www.jneuroengrehab.com/content/7/1/57 Page of 13 the analysis The median was chosen instead of the mean as it is more robust to outliners that may have statistically unbalanced the analysis in our relatively ... hemisphere: diagram of the Δ[O2Hb] amplitude changes with standard error of the mean (SEM) and statistical significances of paired t-test are shown perhaps because they are less ‘automatic’ It has been...
Ngày tải lên: 19/06/2014, 08:20
... On the stability of an n-dimensional quadratic and additive functional equation Math Inequal Appl 9, 153–165 (2006) [12] Kannappan, Pl, Sahoo, PK: On generalizations of the Pompeiu functional ... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, Boston (1998) a [6] Jung, S-M: Hyers–Ulam–Rassias Stability of Functional Equations in Nonlinear Analysis ... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation...
Ngày tải lên: 21/06/2014, 20:20
The impact of technology on team functioning within a given organization
... Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages -of- a- smaller-team.html [ accessed 22 May 2008 ] In addition, about administration side, team work allow manager can ... is also used in team management of Texas Instrument Basically, rely on characteristic of this approach, there is no one best way to manage and the management style appropriate both to the tasks ... One area where the ICT has also a significant impact is in the labor and work environment The development of ICT has contributed a great deal to many aspects of the concept of decent work The latter...
Ngày tải lên: 21/12/2013, 00:26
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... with available antisera [anti-51 kDa, anti-TYKY, anti-30 kDa, anti-18 kDa (NDUFB6)] failed to reveal the presence of any complex I-specific subunits at that position We believe that the band may...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the xb101+ ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of ... concentrations The second primer was derived either from the known 5¢ end of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes...
Ngày tải lên: 16/03/2014, 23:20
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according to the protocols of the TCP/IP suite Data - Application layer ... Data App TCP Header Header Frame Trailer Data Encapsulation – Process of adding a header to the data or any previous set of headers Decapsulation – Process of removing a header 27 Example: Protocol...
Ngày tải lên: 01/04/2014, 12:20
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms Journal of Inequalities and Applications 2011 2011:82 Page of ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the functional Equation 1.1 for the case that X and Y are real...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation ... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 G L Forti, “Hyers-Ulam stability of functional equations in several variables,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx
... from the ER Thus, Ofut1 probably acts as a chaperone in the ER to promote the proper folding of the extracellular domain of Notch, as described in model Although the catalytic and non-catalytic activities ... ponent of Notch signaling pathways Proc Natl Acad Sci USA 2003, 100:5234-5239 12 Sasaki N, Sasamura T, Ishikawa HO, Kanai M, Ueda R, Saigo K, Matsuno K: Polarized exocytosis and transcytosis of Notch ... HO, Sasaki N, Higashi S, Kanai M, Nakao S, Ayukawa T, Aigaki T, Noda K, Miyoshi E, Taniguchi N, Matsuno K: The O-fucosyltransferase O-fut1 is an extracellular component that is essential for the...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo toán học: "The polynomial part of a restricted partition function related to the Frobenius problem" pptx
... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i ... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... In the special case in which the are pairwise relatively prime, each PA,λ(t) for λ = is a constant, and thus QA (t) is a periodic function with average value 0, and this property determines QA...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx
... cooperative report by the Central and East European law initiative of the American Bar Association and the Science and Human Rights Program of the American Association for the Advancement of Science ... Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians following the war in Kosovo Jama 2000, 284(5):569-577 13 American Association for the Advancement ... set of anthropometric variables as independent variables Ethical evaluation The Declaration of Helsinki and Danish law were adhered to in the course of the study Research approval was granted...
Ngày tải lên: 13/08/2014, 14:20
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other listing ... rationale vs no rationale categories 110 Figure 14: Comparison of average CARs of rationale vs no rationale categories 111 Figure 15: Comparison of average AREs by primary rationale and overall...
Ngày tải lên: 30/09/2015, 16:58
Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg
... Academy of Sciences of the United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, ... Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 L C˘adariu and V Radu, “On the stability of the Cauchy functional equation: a fixed point approach,” in Iteration ... bordering transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 P G˘avrut a, A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings,”...
Ngày tải lên: 20/12/2015, 08:14
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
Ngày tải lên: 12/09/2012, 15:05
List the components of a radio system
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
Ngày tải lên: 13/09/2012, 10:52
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
Ngày tải lên: 21/09/2012, 10:39
Guest the meaning of a word
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
Ngày tải lên: 02/10/2012, 12:07
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
Ngày tải lên: 25/10/2012, 11:00