determine the position of the object as a function of time
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... to an increase in the rate
of the initial fast phase, i.e. oxidation of the a chains. The
rates of oxidation are reduced in the presence of chelators of
heavy metal cations in most cases. An ... oxidation mediated by the smooth LPS
was less affected by the presence of EDTA. The rough
S. minnesota LPS increased the initial fast phase of the
reaction, but decreased the rate of the slow phase ... 3A.
The rate of auto-oxidation of cross-linked Hb was greater
than that of Hb A
0,
both in the presence and absence of
EDTA, as has been observed previously [17]. In addition, the
rates of auto-oxidation...
- 6
- 748
- 0
Itzhak Perlman: a citizen of the word, with his violin as a passport
Ngày tải lên :
11/03/2014, 15:38
... music has made him a citizen of the world. He has played in
almost every major city.
Download this story as a PDF
He has won many Grammy awards for his recordings. He has also won Emmy awards ... his playing so special. They say he is able to communicate the
joy he feels in playing, and the emotions that great music can deliver.
Anyone who has attended a performance by Itzhak Perlman will ... Itzhak Perlman: a citizen of the word, with his violin as a passport
STEVE EMBER: Many consider him the greatest concert violinist in the world. The music of
Itzhak Perlman is our program today...
- 2
- 400
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... Idem
MAP2-for
MAP2-rev
GCTTGAAGGCGCTGGATCTGCGACAATAG
GACTGGGCTTTCATCAGCGACAGGTGGC
91489–91517
92431–92404
NC_000067 Idem
Tau-for
Tau-rev
GTGAACCACCAAAATCGGAGAACGAAGC
CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC
78772–78800
79013–78981
NC_000077 Idem
STOP-for
STOP-rev
AGAGTCGGATGCAGTTGCCCGGGCAACA
GGCTCCTCCAGCACCCTCCGGGTCCCG
210–237
657–631
NC_000073 ... Idem
Doublecortin-for
Doublecortin-rev
CCCCAAACTTGTGACCATCATTC
GGAGAAATCATCTTGAGCATAGCG
705–728
967–943
NM_010025 Idem
LIS1-for
LIS1-rev
CGAACTCTCAAGGGC
ATGCATCAGAACCATGCACG
1288–1303
1427–1407
NM_95116 Idem
Tubulin a6 -for
Tubulin a6 -rev
AGCCCTACAATTCCATCCTCACC
GCTGAAGGAGACGATGAGGGTGA
6854–6876
7646–7624
NC_000081 ... Quı
´
mica Biolo
´
gica, Facultad de
Ciencias Quı
´
micas, Universidad Nacional de Co
´
rdoba, Argentina
2 Departamento de Biologı
´
a Molecular, Facultad de Ciencias Exactas, Fı
´
sico-Quı
´
micas...
- 14
- 416
- 0
Báo cáo y học: "Practices of entomophagy and entomotherapy by members of the Nyishi and Galo tribes, two ethnic groups of the state of Arunachal Pradesh (North-East India)" potx
Ngày tải lên :
10/08/2014, 09:21
... to a patient. Wasps have also
been reported as parts of the folk medicine of various
Latin and South American cultures [37,38], as well sub-
Saharan Africa, where they are often associated with
strength ... Pakistan, Ceylon, Burma and
Malaya. Coleoptera Lamellicornia - Lucanidae and Passalidae. Volume IV.
Today and Tomorrows Printers and Publishers; 1949:1-274.
29. Atkinman ET: Fauna of Himalaya ... insect
consumption.
Larval stage is highly esteemed.
Apis cerana Apidae Honey bee Tangik, (G)
Tungu (N)
Nov-Jan Adult and larval stages are
consumed roasted and in form of a
paste. Wings and antennae are
discarded.
Preferred...
- 14
- 623
- 0
Reading Theory as a Microcosm of the Four Skills
Ngày tải lên :
06/09/2013, 10:10
...
unfortunately, are dominated by the grammar-translation method of language teaching,
where, as often as not, English is only taught as a means to accessing literature, be it
classical, technical ... any teacher is the task of knowing his clients.
The notion of needs analysis is absolutely central. Even with as few details as we have
outlined above, there are certain things that we can assume ... to, and do, participate in. This group will be
familiar to many EFL teachers as they are the backbone of many schools in Ireland and
Britain.
One of the most important initial tasks for any...
- 5
- 680
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
Ngày tải lên :
17/03/2014, 23:20
... Georgetown, Texas.
25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal
axis theory of cellular aging. Understanding the Basis of Aging:
the Roles of Mitochondria, Free Radicals, and Antioxidants
(Cadenas, ... maintenance.
Mitochondria are the main source of ROS formation, as
well as the main target for free radical attack. The
accumulation of defective mitochondria within aging cells
suggests that some are not properly autophagocytosed.
Aged ... explanations of aging, such as
Orgel’s error catastrophe theory and the somatic mutation
theory, were based on the idea that aging results from the
accumulation of synthetic errors [26,27]. Adequate support
for...
- 7
- 444
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
Ngày tải lên :
28/03/2014, 20:20
... from the
Marian Chace Foundation to Madeleine Hackney and a grant from the
American Parkinson Disease Association to Gammon Earhart.
References
Argue, J. (2000) Parkinson’s disease and the art of ... Responses
The tango group stated on the exit questionnaire what they liked best
and least about the program. They greatly appreciated the camaraderie
and socialization engendered by the program. Being ... press the wand backwards (arms still behind chair).
e. Finger roll: As fast as you can, then as slow as you can; Rolling out
to the sides of the wand, and back to center. Come up with your
own plan!
From...
- 19
- 648
- 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
Ngày tải lên :
18/06/2014, 22:20
... indicate whether they had
a disease or another health condition diagnosed by a
health professional that had lasted, or was expected to
last, 6 months or more. These data were used to classify
the ... mediation as the percentage of the total effect
that could be attributed to the indirect effect.
The SAS 9.1 software package [29] was used to obtain the
maximum likelihood estimates for each of the ... those
based on full information maximum likelihood estima-
tion (FIML) (available in the Mplus 4.2 [30] software
package) by using all available data to assess whether the
estimates may have been...
- 11
- 619
- 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
18/06/2014, 22:20
... the premature release of unassembled viral
RNA. It may also enhance virus packaging as it appears
that the assembly of coronavirus occurs intracellularly,
probably in the intermediate compartments ... between the
endoplasmic reticulum and Golgi apparatus [24]. Clearly,
this has certain advantages for the virus at certain stages of
its life cycle. In addition, a reduction in the cell surface
expression ... human coronaviruses,
Table 1: Amino acid sequences of the cytoplasmic tail of spike (S) proteins of coronaviruses are compared with the YxxΦ (where x is
any amino acid and Φ is an amino acid...
- 5
- 310
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... complex and the
initiation of intracellular signaling events regulating oxi-
dase assembly and activation has been described [31,32].
The NADPH oxidase
The phagocytic NADPH oxidase plays an essential ... production of
these free radicals can damage tissue adjacent to the sites
of inflammatory action; therefore, the activation of the
NADPH oxidase is tightly controlled though regulated
assembly of the ... Tanino H, Kawakami N, Okamura N, Kodama H,
Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA,
Fujimoto S: Activation of NADPH oxidase in Alzheimer's dis-
ease brains. Biochem...
- 12
- 413
- 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
20/06/2014, 04:20
... essential
for the transport of 3a to the cell surface, consistent with
the role of these motifs in the transportation of other pro-
teins to the plasma membrane [22]. 3a on the cell surface
can also undergo ... 8000 cases of infection and more than 800 fatalities
(World Health Organization, http://www.who.int/csr/
sars/country/en/). A novel coronavirus was identified as
the aetiological agent of SARS ... a YxxΦ motif in
the cytoplasmic domain of 3a has previously been identi-
fied [13]. Furthermore, the juxtaposition of the YxxΦ
motif and a ExD (diacidic) motif was found to be essential
for the...
- 5
- 365
- 0
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
Ngày tải lên :
07/08/2014, 14:20
... bukan dalam bentuk asas. Persamaan baru ini mengekalkan sifat asal
tenaga keaktifan dan kelikatan pada suhu tidak terhingga, dan ia merangkumi pemalar
baru, iaitu kelikatan pada suhu sifar. ... Nisbah kelikatan pada suhu sifar dan kelikatan
pada suhu tidak terhingga merupakan nilai asas untuk pemalar tenaga keaktifan. Model
ini telah diuji dengan enam minyak sayur-sayuran dan kejituannya ... temperature, rheology
Abstrak: Dalam penulisan ini, satu persamaan untuk menggantikan hubungan jenis
Arrhenius telah diterbitkan. Ini adalah kerana pemalar tenaga keaktifan daripada
persamaan...
- 10
- 496
- 1
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
Ngày tải lên :
09/08/2014, 08:23
... irradiator and mice were irradiated
with the indicated total body doses. A 137Cs Gamma Cell
40 (Nordion International, Kanata, Ontario, Canada) was
used as the ionizing radiation source. The ... times and sta-
tistical analysis was done using a student's t-test. Data are
presented as mean ± SD. A probability level of P < 0.05
was considered significant. Statistical analyses of lethality
studies ... capacity that
may provide a clinically translatable method of radiopro-
tection.
Methods
Cell Lines and Treatment
The MiaPaCa2 (pancreatic adenocarcinoma) and DU145
(prostatic adenocarcinoma) cell...
- 9
- 384
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2