... such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... with available antisera [anti-51 kDa, anti-TYKY, anti-30 kDa, anti-18 kDa (NDUFB6)] failed to reveal the presence of any complex I-specific subunits at that position We believe that the band may...
Ngày tải lên: 19/02/2014, 16:20
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the xb101+ ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of ... concentrations The second primer was derived either from the known 5¢ end of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein, ... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state ... 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the multicloning site This plasmid was designated as...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the functional Equation 1.1 for the case that X and Y are real ... doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms Journal of Inequalities and Applications 2011 2011:82 Page of ...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation ... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 G L Forti, “Hyers-Ulam stability of functional equations in several variables,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical...
Ngày tải lên: 22/06/2014, 11:20
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge,...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo toán học: "The polynomial part of a restricted partition function related to the Frobenius problem" pptx
... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i ... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... In the special case in which the are pairwise relatively prime, each PA,λ(t) for λ = is a constant, and thus QA (t) is a periodic function with average value 0, and this property determines QA...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo khoa học: " Water extraction by tree fine roots in the forest floor of a temperate Fagus-Quercus forest" pdf
... hPa and -1.5 MPa was considered as ’plant-available’ The water content directly after a saturating infiltration is taken as the ’saturated water content’ &s; of the humus material This thetas ... throughfall and stand microclimatological data as well as the humus moisture content at a weekly interval as input data After solving the water balance equation, the resulting term is taken as the water ... floor The aerodynamic conductance for water vapour transfer above the forest floor g was approxav imated from wind speed measurements above the canopy The model uses a mass balance approach and...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf
... canonical Nuclear Localization Signals [16,32] in both Tax1 and Tax2, but amino acids 90 to 100 are also critical for the localization of the viral transactivators [16] Using prediction software ... We have also determined here that the NES of Tax2 can direct nuclear export via the CRM1 pathway, and that point mutations at positions 195 and 200 abrogate NES mediated translocation All in all, ... using a Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C and E): Western-blot analysis of GFP and GFP-NES...
Ngày tải lên: 13/08/2014, 09:21
the spillover effects of a downturn in china’s real estate investment
... Argentina Australia Brazil Canada China France Germany India Indonesia Italy Japan Mexico Russian Federation Saudi Arabia South Africa Korea Turkey UK US EU Weighted average Remark: A one-standard-deviation ... Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver Haver IFS Haver Haver Haver Haver Haver Haver Haver IFS Haver IFS Haver Haver Haver Haver ... Argentina: Trade Balance (USD mn) Australia: Trade Balance (USD mn) Brazil: Trade Balance (USD mn) Canada: Trade Balance (USD mn) France: Trade Balance (USD mn) Gernamy: Trade Balance (USD...
Ngày tải lên: 05/11/2014, 14:34
Finding All the Best Swaps of a Minimum Diameter Spanning Tree Under Transient Edge Failures
... second, and perhaps most important, we can evaluate in advance the vitality of an edge, by measuring the degradation of the network functionality (as conveyed by the chosen optimization function) as ... what is the length of a longest simple undirected path in T , starting at v and staying within the subtree of T rooted at y? Furthermore, we compare the diameter of Te/e against that of a real ... which allows to efficiently solve the ABS problem In Section 4, we compare the diameter of the tree obtained as a consequence of a best swap of a failing edge e as opposed to the diameter of a real...
Ngày tải lên: 16/06/2016, 01:35
THE LIMIT OF A FUNCTION
... + − Estimate the value of lim t →0 t SOLUTION The table lists values of the function for several values of t near As t approaches 0, the values of the function seem to approach 0.16666666… ... equal to a 1.3 P16 Example SOLUTION The tables give values of f(x) (correct to six decimal places) for values of x that approach (but are not equal to 1) On the basis of the values, we make the ... (from either side of a) but x ≠ a An alternative notation for lim f ( x ) = L x a is f ( x) → L as x → a which is usually read “f(x) approaches L as x approaches a. ” 1.3 P13 THE LIMIT OF A FUNCTION...
Ngày tải lên: 26/08/2016, 15:18
The Marketing Strategy of a multinational join stock company.doc
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
Ngày tải lên: 27/10/2012, 16:51
EVALUATION OF THE REAL SITUATION OF IMPORT ACTIVITIES OF VIETNAM ENERGY DEVELOPMENT SUPPORT JOINT STOCK COMPANY FROM 2009 TO 2011. PROBLEMS AND SOLUTIONS.
... equilibrium, balance in the same terms of delivery and balance in the total amount of goods exchanged The advantage of reciprocal trade is that with only one contract, firms may import and export all the ... International trade customs and national law - Trading methods on international market are diversified: ordinary transaction, mediated transaction or transaction at fairs - There are varied methods of ... difference in the actual products In most cases, they are manufactured in the same place by the same people and with the same materials Occasionally, manufacturers will give them a different name .In...
Ngày tải lên: 24/07/2013, 09:11
The real world of finance
... capital to each segment based on an allocation derived from some readily available standard measure, such as headcount or 20 THE REAL WORLD OF FINANCE sales Assume that the fictional What A Hamburger! ... these variable costs—so called because they vary based on levels of sales—are not really that controllable, because certain standards of quality must be maintained You can’t really order cheaper ... the chapter, discussing the problems of the fictional What A Hamburger! Actual 30 THE REAL WORLD OF FINANCE companies in the restaurant business provide a real- world look at applications of cash...
Ngày tải lên: 18/12/2013, 09:12
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
Ngày tải lên: 24/12/2013, 01:17
The real story of apple 'think different' campaign
... way It was a billboard campaign that had simple black and white photographs of revolutionary people and events One ad had a photo of Einstein Another had a photo of Thomas Edison Another had a ... were talking about a brand that had fallen off their radar And they were talking a lot Apple clearly had a pulse and while they weren‟t strong as a lion, they certainly gave the impression they ... a photo of Ghandi Another had the famous photo of flowers placed in gun barrels during the protest of the Viet Nam war At the top of each image was the rainbow colored Apple logo and the words...
Ngày tải lên: 08/02/2014, 20:25
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
Ngày tải lên: 19/02/2014, 16:20