50367 give and follow directions on a map

Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you ... sophisticated, DSX panels remain at the very heart of networks That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1 equipment, conti...

Ngày tải lên : 21/12/2013, 07:15

6
378
0

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên : 18/02/2014, 14:20

10
553
0

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

... error bars indicates that the error was too small to appear on the graph The asterisk on the abscissa marks the onset of high-temperature anomaly in August 1998 Hard corals include Scleractinia and ... set at 1°C above the local HotSpot thresholds Because data on solar radiation are not available for the study area during the bleaching event, the HotSpot anoma...

Ngày tải lên : 07/03/2014, 17:20

13
583
0

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-speciﬁc polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiﬀusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên : 23/03/2014, 17:22

7
478
0

Equilibrium potassium coverage and its effect on a Ni tar reforming catalyst in alkali and sulfurladen biomass gasification gases

... carried out in order to establish the K coverage on a Ni- based tar reforming catalyst and its effect on the activity under real steady-state condition K adsorption on the Ni catalyst reached almost ... block active Ni sites and decrease the catalyst activity in traditional steam reforming, it appears to lower the surface S coverage (Â s ) at active Ni...

Ngày tải lên : 01/08/2016, 09:32

10
355
0

Báo cáo y học: "The influence of behavioural and health problems on alcohol and drug use in late adolescence - a follow up study of 2 399 young Norwegians" pptx

... Discussion Summary of main findings Both health- related problems and alcohol intoxications in early adolescence showed influence on frequent alcohol use and initiation of illegal drugs years later, ... behavioural and health problems on late adolescence regular drinking and drug use To explore the impact of gender and early drinking on the r...

Ngày tải lên : 13/08/2014, 18:21

9
343
0

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... medications and equipment on board In Germany, the regulations of the National Federal Aviation Agency (Luftfahrt-Bundesamt, Braunschweig, Germany) and the European Joint Aviation Authorities (JAA; ... Germany) regulate aviation on the national and continental level They regulate by law the contents of an on- board dispensary and the MFK However, in Europe, the regulati...

Ngày tải lên : 25/10/2012, 10:31

6
639
0

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 1

Ngày tải lên : 07/11/2012, 14:17

1
664
4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

... LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4 .2 20 Purposes and typical ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3 .2. 1 The Body of the Convention and its realization 23 4.3 .2. 2 Remarks 2...

Ngày tải lên : 07/11/2012, 14:17

6
634
0

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

... differences between international Declarations and Conventions 32 in terms of discourse structures and major linguistic features International Declarations and International Conventions are legal documents, ... Convention 4 .3 A STUDY OF THE DISCOURSE STRUCTURE AND MAJOR LINGUISTIC FEATURES OF INTERNATIONAL CONVENTIONS ON HUMAN RIGH...

Ngày tải lên : 07/11/2012, 14:17

41
839
3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessib...

Ngày tải lên : 07/11/2012, 14:17

28
611
0

Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium

... Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass transfer effects on MHD flow and heat transfer past a vertical porous plate through a porous medium ... 927-941 [9] Sattar M A Free convection and mass transfer flow through a porous medium past an infinite vertical porous plate with time depend...

Ngày tải lên : 05/09/2013, 14:58

12
493
0

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

... investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and ... relatively higher in mahua biodiesel than that of biodiesel of palm In addition to unsaturation, ignition delay increases with fuel density and iodine value The effect...

Ngày tải lên : 05/09/2013, 15:28

20
483
0

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of ... Results and discussion There are many design and operating parameters which affect the performance characteristics and distillate yield of...

Ngày tải lên : 05/09/2013, 16:11

26
568
0

A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

... by information about the participants The study implementation is outlined along with information about data collection instruments used Finally, details of the nature of the data this study has ... is a reason why the Ministry of Education and Training needs to innovate the way of the second language teaching by applying the communicative approach in teachin...

Ngày tải lên : 07/09/2013, 13:02

77
890
5