... Creating and Managing Trees and Forests Global Catalog and Authentication A global catalog server is also required when a user logs on with a user principal name and the authenticating domain controller ... domains in a forest share a common configuration, schema, and global catalog For example, Contoso, Ltd creates a separate organization called Northwind Traders Contoso, Ltd decides to create a ... Configures a global catalog server ! Starts with the default schema and configuration directory partition information Module 10: Creating and Managing Trees and Forests 13 # Trust Relationships...
Ngày tải lên: 26/10/2013, 23:15
... link state table replaces the gateway address resolution table and adds additional functionality /LQN#6WDWXV# There are only two states for any given link: UP or DOWN; so connection information, ... users to have a standard e-mail address of nwtraders.msft, and use a Domain Name System (DNS) mail exchange (MX) record so that all inbound mail to nwtraders.msft will be received by London, and then ... operational after three connection attempts, the connection is marked as DOWN and the link state is propagated, as discussed previously The bridgehead server in routing group C calculates that an...
Ngày tải lên: 10/12/2013, 16:15
Tài liệu Creating and Managing Microsoft Windows–Serviced Components pptx
... this console can manage Expand Computers and then My Computer and then COM+ Applications to see the installed component applications Each application contains the components that make up that particular ... that the object is part of a transaction and is thus able to extend the transaction space from the database environment to include the software components that perform the data manipulations Each ... Services and Server Components Development with Visual Basic NET / Lind / 222653-6 / Chapter Creating and Managing Microsoft Windows–Serviced Components ...
Ngày tải lên: 11/12/2013, 14:15
Tài liệu Module 4: Creating and Managing Storage Groups and Stores docx
... transactions A transaction is a series of modifications to a database that leaves the database in a consistent state These modifications are called operations An operation is the smallest change ... stores and public information stores A mailbox store contains user data and a public store contains public folder (or shared) data Each store is a logical database that has an associated streaming ... the database and apply transaction logs to that database to bring it up-to-date BETA MATERIALS FOR MICROSOFT CERTIFIED TRAINER PREPARATION PURPOSES ONLY 16 Module 4: Creating and Managing Storage...
Ngày tải lên: 21/12/2013, 05:18
Tài liệu Module 5: Creating and Managing Recipient Objects pptx
... an e-mail address Creating an E-mail Address for a Contact You can establish an e-mail address for a contact when you create the contact Alternatively, you can establish an e-mail address after ... involves managing e-mail addresses, managing rights and permissions, and moving mailboxes ! Managing Recipient E-mail Addresses ! Managing Rights and Permissions ! Moving Mailboxes A recipient may have ... mailbox Explain the various configuration options available Demonstrate how to create a mail-enabled contact and a mail-enabled group ! Managing Recipient Objects This topic covers information...
Ngày tải lên: 21/12/2013, 05:18
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you ... sophisticated, DSX panels remain at the very heart of networks That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional ... you can save valuable floor space By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels to 14—for a total...
Ngày tải lên: 21/12/2013, 07:15
Tài liệu Creating and Managing Microsoft .NET Remoting Objects pptx
... that the application cannot access any resources directly through that boundary In order for an application located in one application domain to communicate with another application in a separate ... performed by an object that operates in an asynchronous manner C Change the application to use an n-tier model, and upgrade the server the database is on D Change the application to take advantage of ... class declaration must have a constructor that takes a character as its parameter ' Class that contains the data for ' the Char event Derives from System.EventArgs ' Public Class CharEventArgs...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Creating and Managing Microsoft XML Web Services ppt
... / Chapter XML Web Services Explained ■ XML Extensible Markup Language is the standard that gives you the ability to package data and the structural definition (metadata) of that data in one document ... / Chapter Creating and Managing Microsoft XML Web Services client are separate and distinct The communication to and from the service must meet the Internet standards, and the methods that will ... and ASP.NET applications, as well as ISAPI (Internet Server Application Programming Interface) applications, and this is not an exhaustive list XML Web Service Consumer The XML web service consumer...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Module 6: Creating and Managing Public Folders doc
... Publishing Author Create and Read items and files, Modify and Delete items and files you create, and Create subfolders Author Create and Read items and files, and Modify and Delete items and files ... environment are always mail-enabled and cannot be mail-disabled BETA MATERIALS FOR MICROSOFT CERTIFIED TRAINER PREPARATION PURPOSES ONLY Module 6: Creating and Managing Public Folders 15 # Configuring ... You can also create an additional tree at a remote location so that the users at that location can access data that is specifically relevant to them Each public folder tree stores its data in a...
Ngày tải lên: 17/01/2014, 08:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 FEBS Journal 275 (2008) 5855–5864 ª 2008 The Authors Journal compilation ª 2008 FEBS A Pappachan ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was...
Ngày tải lên: 18/02/2014, 14:20
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... shelf lagoon, as well as on the outer barrier reef and in the lagoon at Glovers Reef, an atoll-like carbonate platform seaward of the barrier reef (McClanahan and Muthiga 1998; Aronson and Precht ... to obtain mean estimates of the abundance of juvenile corals and, separately, the abundance of E viridis for each depth at each station in each survey year Among-station means and standard errors ... personal communication; R.B .A and W.F.P., personal observation) As a result, E viridis has been the most abundant herbivore at Channel Cay and the other shoals for decades at least, and it consumed...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... conclusion was confirmed and the a configuration of ara4dHex established using a NOESY experiment This showed H1,H3 and H1,H5 correlations for Rha at d 4.97/4.06 and 4.97/3.58, which are characteristic ... Fuc and 3-substituted Rha in the molar ratio : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing one...
Ngày tải lên: 23/03/2014, 17:22
Creating and Managing Tables potx
... Variable-length character data CHAR(size) Fixed-length character data NUMBER(p,s) Variable-length numeric data DATE Date and time values LONG Variable-length character data up to gigabytes Character data up ... New data type storage is available Enhancements have been made to time zones and local time zone Data Type Description TIMESTAMP Date with fractional seconds INTERVAL YEAR TO MONTH Stored as an ... TIMESTAMP data type is an extension of the DATE data type • It stores the year, month, and day of the DATE data type, plus hour, minute, and second values as well as the fractional second value...
Ngày tải lên: 29/03/2014, 16:20
creating and managing superiou customer value
... as ‘‘transaction costs,’’ as the ‘‘costs of negotiating and concluding a separate contract for each exchange transaction which takes place on a market.’’ Coase sees the firm on one hand and the ... Georgia State University, Atlanta, GA, USA Bruno Busacca Bocconi University, Milan, Italy Michele Costabile University of Calabria, Arcavacata, Calabria, Italy Bernard Cova Euromed Marseille, Marseille, ... theoretical rationale for regarding relationships as having value and for regarding the assessment of their value as important, on the basis that they are intangible assets of an organization At a level...
Ngày tải lên: 25/11/2015, 15:44
Module 11 creating and managing public folders in exchange 2000
... create, and Create subfolders Author Create and Read items and files, and Modify and Delete items and files you create Reviewer Read items and files only Contributor Create items and files only ... functionality of age limits and where age limits can be applied Age limits allow the information store to place an expiration date on information in the database Age limits can be set on a per ... users and groups are used in the ACL Anonymous access permissions are assigned to the special ANONYMOUS LOGON account and Default access permissions are assigned to the Everyone group When evaluating...
Ngày tải lên: 04/12/2015, 16:54
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k ... (Shizuoka, Japan), respectively RNA and DNA manipulation was generally performed as described previously [9] Total RNA was extracted from basal tissue of the barnacle by a Total RNA Separator kit ... phosphorylated, for reverse transcription; 5¢-GTG CCG GAG CCC TGC GTG GC-3¢ and 5¢-AAC TCC GTG GAG AAG AAG AA-3¢ for the first PCR amplification; and 5¢-TGC TGA CCG ACG CGC CTC CT-3¢ and 5¢-GGC AAC ACG...
Ngày tải lên: 16/03/2014, 05:20
2012 Search Marketing - SEO Edition - Research and Insights on Creating and Capitalizing on a Rich End-User Search Experience potx
... 82 Chart: Allocation of online marketing dollars, by organization size 83 Chart: Allocation of online marketing dollars, by SEO maturity phase 84 Chart: Allocation of online marketing ... that their products and services are found across all formats and venues, organizations must be strategic with their planning and processes, and ever-savvy with the creation and optimization ... Organizations with a process for planning, executing and measuring SEO programs Chart: Organizations in each phase of SEO marketing maturity, by primary channel Chart: Organizations in each phase...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"
... (Luftfahrt-Bundesamt, Braunschweig, Germany) and the European Joint Aviation Authorities (JAA; Cologne, Germany) regulate aviation on the national and continental level They regulate by law the contents ... registered commercial aircraft with more than one flight attendant or 12 seats to carry an automatic external defibrillator (AED) Although most large national European national airlines carry AEDs, some ... USA, Canada and the UK physicians on airplanes are not required by law to respond to a call for help [8] In contrast, the European Union and Australia require physicians on board to so Physicians...
Ngày tải lên: 25/10/2012, 10:31