Input and output
... use scanf and/ or sscanf to do the input and number conversion. 7.5 File Access The examples so far have all read the standard input and written the standard output, which are automatically defined ... functions that provide input and output, string handling, storage management, mathematical routines, and a variety of other services for C programs. We will concentrate on input and output The ANSI ... files and providing pointers for them. These files are the standard input, the standard output, and the standard error; the corresponding file pointers are called stdin, stdout, and stderr, and are...
Ngày tải lên: 30/09/2013, 06:20
... not actually need. For many of us the major disadvantage of shopping in supermarkets id that it is time consuming and it takes a while to getthere and back. Big stores are also quite dangerous ... pirce of one" are always found there. One the other hand shopping in supermarkets can be annoying beckause there is a big choice which can cause confusion. People often buy unnecessary things ... If something goes wrong with your products, you simply show your recipt and you are given a new one or your money back. Not to forget about sales and special offers such as "buy one get one...
Ngày tải lên: 23/10/2013, 02:15
Government Bonds and Their Investors: What Are the Facts and Do They Matter? ppt
... Taiwan, Thailand, and Turkey (from 2002). 3/ Includes Ecuador, Venezuela, Indonesia, Bahrain, Iran, Iraq, Kuwait, Oman, Qatar, Saudi Arabia, the United Arab Emirates, Algeria, Gabon, Libya, and Nigeria. 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 ... central bank and public pension funds which are classified as financial sector in ESA95. Data on central bank holdings are available for all countries except for Korea, Greece, Ireland, and Spain. ... other intragovernmental holdings are often available for other countries, social security and public pension fund holdings are readily available only for Canada and Japan. For the United States,...
Ngày tải lên: 15/03/2014, 07:20
Input and output of dissolved organic and inorganic nitrogen in subtropical forests of South China under high air pollution docx
... mineralization and nitrification stimulated by abundant precipitation in combination with high temperature (Fig. 1). Such climatic conditions may also have stimulated net mineralization rate in the ... climate is warm and humid. The mean annual rainfall of 1927 mm has a distinct seasonal pattern, with 75% falling from March to August and2 5 only 6% from December to February (Huang and Fan, 1982). ... broadleaf forest in Ailaoshan of Yunnan (Gan et al., 1995), 5.9 kg N ha −1 yr −1 in a seasonal rain forest in Xishuanbanna of Yunan (Sha et al., 2002), and 6.1 kg N ha −1 yr −1 in a mountain rain forest...
Ngày tải lên: 23/03/2014, 00:20
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
Ngày tải lên: 02/06/2014, 15:10
Báo cáo sinh học: "Q&A: What are pharmacological chaperones and why are they interesting" pdf
Ngày tải lên: 06/08/2014, 19:21
báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx
Ngày tải lên: 10/08/2014, 10:23
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... That’s why ADC, The Broadband Company ™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional DSX panels to improve density, manageability, and ... Signal Cross-connect) panels are an integral part of operating and maintaining communications networks. As technology continues to become more sophisticated, DSX panels remain at the very heart ... and bays, and you can save valuable floor space. By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels...
Ngày tải lên: 21/12/2013, 07:15
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... for phosphorus scavenging and remobilization when the cells are under stress and consequently mononucleotide phosphate concentrations are high. Materials and methods Cloning and purification of St SurE The ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
Ngày tải lên: 18/02/2014, 14:20
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... representation and as propor- tional covers for statistical analysis. Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual substrate components among ... personal communication; R.B .A. and W.F.P., personal observation). As a result, E. viridis has been the most abundant herbivore at Channel Cay and the other shoals for decades at least, and it consumed most ... quadrats at the same time as juvenile corals. Stations 1 and 2 were sampled in 1994 with 51 quadrats at each depth at each station. Station 3 was added for the 1999–2001 counts, and 25 quadrats...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... above for sugar analysis, and the partially methylated monosaccharides derived were conver- ted into the alditol acetates and analysed by GLC-MS. Smith degradation OPS-I, OPS-II and the O-deacetylated ... O-polysaccharide from Citrobacter braakii O6 (Eur. J. Biochem. 270) 2737 residues are a- linked (compare published data for a -and b-rhamnopyranose, a- andb-fucopyranose [26]). This con- clusion was ... Gunnarsson, A. (1987) N- and O-Alkylation of glycoconjugates and polysaccharides by solid base in dimethyl sulphoxide/alkyl iodide. Glycoconjugate J. 4, 239–245. 21. Romanowska, A. , Gamian, A. ,...
Ngày tải lên: 23/03/2014, 17:22
Báo cáo khoa hoc:" Pituitary macroadenomas: are combination antiplatelet and anticoagulant therapy contraindicated? A case report" pot
Ngày tải lên: 11/08/2014, 10:22
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
... STRUCTURE AND SOME MAJOR LINGUISTIC FEATURES OF THE INTERNATIONAL DECLARATION ON HUMAN RIGHTS 3.1 Definition of an International Declaration 10 3.2 Purposes and typical legal characteristics ... THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 20 4.2 Purposes and typical legal characteristics of the International Convention on Human Rights 20 4.2.1 ... realization 30 4.3.3.2 Remarks 30 Chapter V Conclusion − Some notes oN THE similarities and differences between international Declarations and Conventions in terms of discourse structures and...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
... indirectly'; 'to and from'; 'at the time of ratification or at any time thereafter'; 'any Contracting State or any national of a Contracting State'. They are effective ... exist in a Declaration. 'States Parties' of a Convention refers to its contracting states. Due to the purposes and characteristics of a Declaration and of a Convention, which are different ... that do not appear in a Declaration. All the differences in discourse analysis of International Declarations and Conventions can be explained by one reason: that is the distinction in legal...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take ... International Covenant on Economic, Social and Cultural Rights (in particular in article 10) and in the statutes and relevant instruments of specialized agencies and international organizations ... production, exchange and dissemination of such information and material from a diversity of cultural, national and international sources; (c) Encourage the production and dissemination of children's...
Ngày tải lên: 07/11/2012, 14:17
Following are some pictures of StudyLink International and the staff.
... Auckland and Singapore, who assist students with arrival orientation and ongoing welfare support. In addition to the Study Abroad business, the company offers Training Solutions to corporate and ... Hong Trang – Finance and Human Resources Manager – my supervisor who gave me a chance to work at a wonderful position and always supported me with new things. Ms. Dong Thuy Cam – Finance and ... theories I have learnt and practical assignments at the company, and how to apply these theories. At the company, I was positioned at the Front Office Management, working as a receptionist. I...
Ngày tải lên: 05/04/2013, 22:29