learning from labeled and unlabeled data on a directed graph
Báo cáo khoa học: "Boosting Statistical Word Alignment Using Labeled and Unlabeled Data" ppt
... domain: Labeled Data (LD) and Unlabeled Data (UD). The Chinese sentences in the data are automatically segmented into words. The statis-tics for the data is shown in Table 1. The labeled data ... labeled data and large amounts of unlabeled data. In this algorithm, we built an in-terpolated model by using both the labeled data 919 and the unlabeled data. This interpolated model was employed ... 2006.c2006 Association for Computational LinguisticsBoosting Statistical Word Alignment Using Labeled and Unlabeled Data Hua Wu Haifeng Wang Zhanyi Liu Toshiba (China) Research and Development...
- 8
- 451
- 1
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites ... forphosphorus scavenging and remobilization when thecells are under stress and consequently mononucleotidephosphate concentrations are high.Materials and methodsCloning and purification of St SurEThe ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
- 10
- 553
- 0
How Do Earnings Change When Reservists Are Activated - A Reconciliation of Estimates Derived from Survey and Administrative Data docx
... attributable to activation derived from administrative data by year activated, activation duration, pay grade, and military occupation. ere are numerous examples where administrative and survey data ... JUSTICEEDUCATIONENERGY AND ENVIRONMENTHEALTH AND HEALTH CAREINTERNATIONAL AFFAIRSNATIONAL SECURITYPOPULATION AND AGINGPUBLIC SAFETYSCIENCE AND TECHNOLOGYSUBSTANCE ABUSETERRORISM AND HOMELAND ... and administrative data differ. Matched SOFS-R and Administrative data Our analyses employ a unique dataset consisting of individual SOFS-R responses matched to administrative data on military...
- 74
- 228
- 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... and bays, and you can save valuable floor space. Byconfiguring a low-profile 84-circuit DSXi panel measuring only four inches high,you can increase your bay capacity from 11 standard panels ... That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1equipment, continues to innovate and enhance traditional DSX panels toimprove density, manageability, and ... Signal Cross-connect) panels are an integral part of operating and maintainingcommunications networks. As technology continues to become moresophisticated, DSX panels remain at the very heart...
- 6
- 378
- 0
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf
... ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); // Create the DataAdapter and ... Session["DataSource"] = dt; return dt; } private DataTable UpdateDataSource(DataTable dt) { // Create a DataAdapter for the update. SqlDataAdapter da = new SqlDataAdapter("SELECT ... table and stores the DataTable to a Session variable to cache the data source for the DataGrid. UpdateDataSource( ) This method creates a DataAdapter and uses it with updating logic generated...
- 10
- 387
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... Service) and K.S. Casey(NOAA/National Oceanographic Data Center) with SST data and climatology processing, and K. Kilpatrick, E. Kearns, and V. Halliwell (Rosenstiel School of Marine and Atmospheric ... at each station in each survey year.Among-station means and standard errors for each depth and survey year were calculated from those within-station means. Thepooled data, expressed as counts ... representation and as propor-tional covers for statistical analysis. Repeated-measures analysis ofvariance (ANOVA) was used to compare the proportional coversof individual substrate components among...
- 13
- 583
- 0
3.Storing Data on a Disk.ppt
- 30
- 215
- 0
Tài liệu Remittances from Germany and their Routes to Migrants'''' Origin Countries: A study on five selected countries docx
... ProductGDR German Democratic RepublicGTZ German Technical CooperationILO International Labour OrganisationIMF International Monetary FundIOM International Organisation for MigrationKWG Kreditwesengesetz ... Germany, withparticular attention to Berlin and Hesse).Hockenos, Paul (2003): Homeland-Calling. ExilePatriotism and the Balkan-Wars.International Labour Organization (1999): MigrantWorkers' ... Volksbank and Raiffeisenbank banks in Rhineland-Westphalia, and the commercial banks.20The central bank for the Volksbank and Raiffeisen-bank banks.21Western Union's online list shows only...
- 28
- 374
- 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
... increasing the pH slightly to a valueof 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. AtTable ... °C was 7.5 and the pH at 37 °C was 7.2. The concentration of F6P was held at 0.5 mM. All otherassay conditions are detailed in the Materials and methods. Data are means S.E.M., n ẳ 4 separate ... retained at 5 °C at pH 7.5 and indicate that changesin kinetic parameters were most probably due to tem-perature alone. Sensitivity to adenylates (ATP inhibi-tion, AMP and ADP activation) was...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: "Learning with Unlabeled Data for Text Categorization Using Bootstrapping and Feature Projection Techniques" doc
... general, related approaches for using unlabeled data in text categorization have two directions; One builds classifiers from a combination of labeled and unlabeled data (Nigam, 2001; Bennett and ... labeled data. While labeled data are difficult to obtain, unlabeled data are readily available and plentiful. Therefore, this paper advocates using a bootstrapping framework and a feature projection ... second, we use the TCFP classifier with robustness from noisy data (Ko and Seo, 2004). How can labeled training data be automatically created from unlabeled data and title words? Maybe unlabeled...
- 8
- 443
- 0
COMBINING EVIDENCE ON AIR POLLUTION AND DAILY MORTALITY FROM THE 20 LARGEST US CITIES: A HIERARCHICAL MODELLING STRATEGY potx
... lag structure and prior distributions.2. Description of the databasesThe analysis database included mortality, weather and air pollution data for the 20 largestmetropolitan areas in the USA ... a city has more than one weather-station, we took the average of the measurements from all available stations. The PM10 and ozone O3 data were also averaged over all monitors in a county. ... morbidity and mortality from respiratory and cardiovascular diseases increase with levels of particulate airpollution below the current national ambient air quality standard for particulate matter...
- 40
- 526
- 0
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... Large Corpora.Kiyotaka Uchimoto, Qing Ma, Masaki Murata, Hi-romi Ozaku, Masao Utiyama, and Hitoshi Isahara.2000. Named entity extraction based on a maxi-mum entropy model and transformation ... .According to this ordering, two candidates canhave the same rank. One of them might assert that a certain word is an organization’s name and an-other candidate might assert that it is a person’sname. ... from <ORGANIZATION>OO-SAKA-TO-YO-TA</ORGANIZATION> (= Os-aka Toyota) because Japanese POS taggers knowthat TO-YO-TA is an organization name (a kindof proper noun).*:*:location-name,...
- 8
- 530
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... loams 0 to 8 PvC Plaisted and Howland very stony loams 8 to 15 RaA Red Hook and Atherton silt loams 0 to 2 RaB Red Hook and Atherton silt loams 2 to 8 SaA Salmon silt loams 0 to 2 SaB Salmon ... climate and vegetation cause little of the variation in soils along the St. John River. Parent material, landform and age are independent variables in soil formation in northern Maine and are ... referenced data into covers that contain information about spatial relationships and information about points and areas. The conversion process involved hand-digitizing the soil boundaries from the...
- 131
- 599
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25