... domain: Labeled Data (LD) and Unlabeled Data (UD). The Chinese sentences in the data are automatically segmented into words. The statis- tics for the data is shown in Table 1. The labeled data ... labeled data and large amounts of unlabeled data. In this algorithm, we built an in- terpolated model by using both the labeled data 919 and the unlabeled data. This interpolated model was employed ... 2006. c 2006 Association for Computational Linguistics Boosting Statistical Word Alignment Using Labeled and Unlabeled Data Hua Wu Haifeng Wang Zhanyi Liu Toshiba (China) Research and Development...
Ngày tải lên: 08/03/2014, 02:21
... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... for phosphorus scavenging and remobilization when the cells are under stress and consequently mononucleotide phosphate concentrations are high. Materials and methods Cloning and purification of St SurE The ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
Ngày tải lên: 18/02/2014, 14:20
How Do Earnings Change When Reservists Are Activated - A Reconciliation of Estimates Derived from Survey and Administrative Data docx
... attributable to activation derived from administrative data by year activated, activation duration, pay grade, and military occupation. ere are numerous examples where administrative and survey data ... JUSTICE EDUCATION ENERGY AND ENVIRONMENT HEALTH AND HEALTH CARE INTERNATIONAL AFFAIRS NATIONAL SECURITY POPULATION AND AGING PUBLIC SAFETY SCIENCE AND TECHNOLOGY SUBSTANCE ABUSE TERRORISM AND HOMELAND ... and administrative data differ. Matched SOFS-R and Administrative data Our analyses employ a unique dataset consisting of individual SOFS-R responses matched to administrative data on military...
Ngày tải lên: 23/03/2014, 02:20
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... and bays, and you can save valuable floor space. By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels ... That’s why ADC, The Broadband Company ™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional DSX panels to improve density, manageability, and ... Signal Cross-connect) panels are an integral part of operating and maintaining communications networks. As technology continues to become more sophisticated, DSX panels remain at the very heart...
Ngày tải lên: 21/12/2013, 07:15
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf
... ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); // Create the DataAdapter and ... Session["DataSource"] = dt; return dt; } private DataTable UpdateDataSource(DataTable dt) { // Create a DataAdapter for the update. SqlDataAdapter da = new SqlDataAdapter("SELECT ... table and stores the DataTable to a Session variable to cache the data source for the DataGrid. UpdateDataSource( ) This method creates a DataAdapter and uses it with updating logic generated...
Ngày tải lên: 26/01/2014, 10:20
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... Service) and K.S. Casey (NOAA/National Oceanographic Data Center) with SST data and climatology processing, and K. Kilpatrick, E. Kearns, and V. Halliwell (Rosenstiel School of Marine and Atmospheric ... at each station in each survey year. Among-station means and standard errors for each depth and survey year were calculated from those within-station means. The pooled data, expressed as counts ... representation and as propor- tional covers for statistical analysis. Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual substrate components among...
Ngày tải lên: 07/03/2014, 17:20
Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment
Ngày tải lên: 13/05/2014, 12:19
Fault tree synthesis from a directed graph model for a power distribution network
Ngày tải lên: 03/01/2014, 19:37
GRAPH BASED MINING ON WEIGHTED DIRECTED GRAPHS FOR SUBNETWORKS AND PATH DISCOVERY
Ngày tải lên: 24/08/2014, 11:53
Báo cáo toán học: "A Gessel–Viennot-Type Method for Cycle Systems in a Directed Graph" doc
Ngày tải lên: 07/08/2014, 13:21
Tài liệu Remittances from Germany and their Routes to Migrants'''' Origin Countries: A study on five selected countries docx
... Product GDR German Democratic Republic GTZ German Technical Cooperation ILO International Labour Organisation IMF International Monetary Fund IOM International Organisation for Migration KWG Kreditwesengesetz ... Germany, with particular attention to Berlin and Hesse). Hockenos, Paul (2003): Homeland-Calling. Exile Patriotism and the Balkan-Wars. International Labour Organization (1999): Migrant Workers' ... Volksbank and Raiffeisenbank banks in Rhineland-Westphalia, and the commercial banks. 20 The central bank for the Volksbank and Raiffeisen- bank banks. 21 Western Union's online list shows only...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
... increasing the pH slightly to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. At Table ... °C was 7.5 and the pH at 37 °C was 7.2. The concentration of F6P was held at 0.5 m M. All other assay conditions are detailed in the Materials and methods. Data are means S.E.M., n ẳ 4 separate ... retained at 5 °C at pH 7.5 and indicate that changes in kinetic parameters were most probably due to tem- perature alone. Sensitivity to adenylates (ATP inhibi- tion, AMP and ADP activation) was...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Learning with Unlabeled Data for Text Categorization Using Bootstrapping and Feature Projection Techniques" doc
... general, related approaches for using unlabeled data in text categorization have two directions; One builds classifiers from a combination of labeled and unlabeled data (Nigam, 2001; Bennett and ... labeled data. While labeled data are difficult to obtain, unlabeled data are readily available and plentiful. Therefore, this paper advocates using a bootstrapping framework and a feature projection ... second, we use the TCFP classifier with robustness from noisy data (Ko and Seo, 2004). How can labeled training data be automatically created from unlabeled data and title words? Maybe unlabeled...
Ngày tải lên: 20/02/2014, 16:20
COMBINING EVIDENCE ON AIR POLLUTION AND DAILY MORTALITY FROM THE 20 LARGEST US CITIES: A HIERARCHICAL MODELLING STRATEGY potx
... lag structure and prior distributions. 2. Description of the databases The analysis database included mortality, weather and air pollution data for the 20 largest metropolitan areas in the USA ... a city has more than one weather- station, we took the average of the measurements from all available stations. The PM 10 and ozone O 3 data were also averaged over all monitors in a county. ... morbidity and mortality from respiratory and cardiovascular diseases increase with levels of particulate air pollution below the current national ambient air quality standard for particulate matter...
Ngày tải lên: 06/03/2014, 16:20
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
... Large Corpora. Kiyotaka Uchimoto, Qing Ma, Masaki Murata, Hi- romi Ozaku, Masao Utiyama, and Hitoshi Isahara. 2000. Named entity extraction based on a maxi- mum entropy model and transformation ... . According to this ordering, two candidates can have the same rank. One of them might assert that a certain word is an organization’s name and an- other candidate might assert that it is a person’s name. ... from <ORGANIZATION>OO- SAKA-TO-YO-TA</ORGANIZATION> (= Os- aka Toyota) because Japanese POS taggers know that TO-YO-TA is an organization name (a kind of proper noun). *:*:location-name,...
Ngày tải lên: 08/03/2014, 05:20