Pressure drop prediction of a gasifier bed with cylindrical biomass pellets

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... S-oxidation of thioanisole As the above results showed that the best system for the S-oxidation of thioanisole associated H2O2 as an oxidant with MP8 as a catalyst in the presence of tBuOH as an ... case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is chara...

Ngày tải lên: 19/02/2014, 12:20

7 448 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

... Annals of Mathematics, 163 (2006), 723–741 The number of extensions of a number field with fixed degree and bounded discriminant By Jordan S Ellenberg and Akshay Venkatesh* Abstract We give an ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute o...

Ngày tải lên: 06/03/2014, 08:21

20 479 0
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

... ADP trioseP + NAD+ fi BPG + NADH BPG + ADP fi ACA + ATP ACA + NADH fi NAD+ ATP fi ADP Glc + ATP fi ADP trioseP + NADH fi NAD+ ACA Ð ACA x ACAx fi GAPDH: lowpart: ADH: ATPase: storage: glycerol: difACA: ... are evaluated by calculating the eigenvalues of the Jacobian matrix at a particular stationary state, common to all models In this case, the basic dynamic property is oscillation Models w...

Ngày tải lên: 07/03/2014, 11:20

16 492 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt

báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt

... investigated MiL in a representative survey of the German population with an individualized assessment tool, the Schedule for Meaning in Life Evaluation (SMiLE) In the open answers, 13 MiL categories ... Quality of Life s1 sn satisfaction with each MiL area SEIQoL Schedule for the Evaluation of Individual Quality of Life Page of (page numb...

Ngày tải lên: 20/06/2014, 16:20

8 382 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx

... that a TNAR is available in this latter case A Unknown parameters (µs, φs) and known total noise (R, C) Under the assumptions A1 and A2 , assuming known parameters R, C and s and unknown parameters ... performance In a same way, the O9 detector, which assumes that all the parameters of the sources are unknown, has the lowest performance Moreover, for a...

Ngày tải lên: 21/06/2014, 00:20

45 467 0
Báo cáo hóa học: " Whispering gallery modes in photoluminescence and Raman spectra of a spherical microcavity with CdTe quantum dots: anti-Stokes emission and interference effects" ppt

Báo cáo hóa học: " Whispering gallery modes in photoluminescence and Raman spectra of a spherical microcavity with CdTe quantum dots: anti-Stokes emission and interference effects" ppt

... splitting (b) Result of fast Fourier analysis adjacent TE and TM modes) again in agreement with measured modes separation (Fig 3a) Periodicities of 0.44 and 0.33 nm, obtained from the Fourier analysis, ... and Raman spectra from a monolayer of CdTe quantum dots were observed due to strong coupling with the spherical microcavity Simultaneous Stokes and ant...

Ngày tải lên: 22/06/2014, 22:20

6 329 0
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx

ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx

... consideration by an operator equation, approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on ... of taking of the normal component of a trace on the boundary of a function defined on Ω0 The operator γn 236 On weak solutions of the equat...

Ngày tải lên: 23/06/2014, 00:20

31 266 0
Báo cáo hóa học: " Warped Linear Prediction of Physical Model Excitations with Applications in Audio Compression and Instrument Synthesis" pdf

Báo cáo hóa học: " Warped Linear Prediction of Physical Model Excitations with Applications in Audio Compression and Instrument Synthesis" pdf

... recording of a classic guitar and an electric guitar for testing The coding of the guitar tones using a combination of physical modelling and warped linear predictive coding is outlined in Section ... real-time parameterization and coding problem for string modelling in the marriage of two common techniques, the basic plucked string physical model and warped l...

Ngày tải lên: 23/06/2014, 01:20

9 299 0
Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx

Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx

... family G ⊂ P[n] a k-base of P[n] if every x ⊂ [n] can be expressed as a union of at most k sets in G; they conjectured that for any k ≤ n, any k-base of P[n] is at least as large as Fn,k ... generalization of a theorem of Alon and Frankl, proved via an Erd˝s-Stone o type result As observed in [1], for a k-generator G, we have the following trivial bound on |G| = m The numb...

Ngày tải lên: 07/08/2014, 21:21

6 215 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx

Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx

... important role in determining the mutation class of a quiver In [2], the authors prove that the mutation class of an adjacency matrix associated to a triangulation of a bordered surface with marked ... graph has a unique decomposition, so does the original graph the electronic journal of combinatorics 18 (2011), #P91 43 As an application of the al...

Ngày tải lên: 08/08/2014, 14:23

45 262 0
báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx

báo cáo khoa học: "Kaposiform hemangioendothelioma in tonsil of a child associated with cervical lymphangioma: a rare case report" pptx

... region, including cases associated with KMP, while cases unassociated with KMP None of the cases in that study was noted in the tonsil region KMP is more commonly seen in cases occurring in abdominal ... surgical excision Increasing size, risk of coagulopathy are indicators for therapeutic interventions in such cases Medical treatment is included in cases associated...

Ngày tải lên: 09/08/2014, 01:24

8 471 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a)...

Ngày tải lên: 09/08/2014, 06:22

11 593 0
báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt

báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt

... et al.: The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report Journal of Medical Case Reports 2011 5:393 Submit your next manuscript ... 18 August 2011 Published: 18 August 2011 Figure Dorsal view of the right hand of the cadaver of a 76year-old man *Supernumerary f...

Ngày tải lên: 10/08/2014, 23:20

2 221 0
w