formation of a seaweed bed using carbon fibers

CARBON NANOTUBES 2012 pptx

CARBON NANOTUBES 2012 pptx

... groups for carbon nanotubes can be either symmorphic [such as armchair (n,n)and zigzag Physics of carbon nanotubes 29 Table Parameters of carbon nanotubes Symbol _ Name Value Formula carbon- carbon ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22 -carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube ... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube...

Ngày tải lên: 05/03/2014, 15:21

202 591 0
CARBON NANOTUBES pot

CARBON NANOTUBES pot

... groups for carbon nanotubes can be either symmorphic [such as armchair (n,n)and zigzag Physics of carbon nanotubes 29 Table Parameters of carbon nanotubes Symbol _ Name Value Formula carbon- carbon ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22 -carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube ... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube...

Ngày tải lên: 27/06/2014, 17:20

202 1,3K 0
CARBON NANOTUBES.Elsevier Journals of Related Interest Applied Superconductivity Carbon Journal pdf

CARBON NANOTUBES.Elsevier Journals of Related Interest Applied Superconductivity Carbon Journal pdf

... groups for carbon nanotubes can be either symmorphic [such as armchair (n,n)and zigzag Physics of carbon nanotubes 29 Table Parameters of carbon nanotubes Symbol _ Name Value Formula carbon- carbon ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22 -carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube ... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube...

Ngày tải lên: 27/06/2014, 17:20

202 490 0
Long run effects of government policy in the growth model with creative destruction

Long run effects of government policy in the growth model with creative destruction

... preferable states with maximal social welfare and optimal growth rate in growth theory, because it lacks theoretical guarantee that a decentralized economy will automatically evolve into an optimal ... time paths of variables such as per capita capital asset, leading-edge productivity and variety of intermediate goods 4.1 Steady-State Equilibrium Results of Social Planner’s Economy At any given ... t Stationary is also imposed on the fraction of Qt At Qt At Qt At final output allocated to vertical R&D nt , the fraction of final output allocated to horizontal R&D ht , and interest rate rt...

Ngày tải lên: 10/11/2015, 11:07

79 265 0
Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf

Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf

... much of this is social pressure and how much is genetic? I am convinced that while children's brains have a natural ability to absorb new information as part of their developmental growth, much of ... physical challenges, their motivation can often be higher than a child's Unfortunately, society does not encourage many adults to learn People are busy with families and work, and some adults may ... as the family’s religion or language may not even be available in the school Other parents may disagree with the aims of the school curriculum, preferring for academic, social or cultural reasons...

Ngày tải lên: 25/01/2014, 19:20

9 661 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... fluorescent images of their dendrites were analyzed with neurolucida software (MBF Bioscience, Williston, VT, USA) Image data were statistically quantified by repeated-measures analysis of variance with ... M1406; Sigma-Aldrich), EGFP (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, ... neurons A previous in vitro study indicated that the RasGEF activity of v-KIND induces the phosphorylation of MAP2 by JNK1 and ⁄ or ERK via the activation of the Ras–Raf–MAP kinase pathway [12]...

Ngày tải lên: 14/02/2014, 19:20

11 659 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... was obtained by PCR from the plasmid pET21 SIC1 [32] with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI ... hexahistidine tag was obtained by PCR using the pET2 1a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction ... disappearance of the full-length polypeptide as early as after of incubation Proteolysis of PNT-GFP proceeded with the formation of a relatively stable fragment with an apparent mass of 31 kDa...

Ngày tải lên: 18/02/2014, 04:20

14 673 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... conjugated upper primer was 5¢-GGAATTCCGCCACCATGCCATA CGATGTTCCAGATTACGCT-3¢ The XbaI restriction site-conjugated lower primer was 5¢-GCTCTAGAGCTCA TTTCCGACTGAAGA-3¢ Amplification of bcl-XL cDNA was ... addition of ADR, and used for immunoblot analysis of pro-caspase and caspase (C) Cells were treated with EGF and ADR as described in (A) Lysates were prepared at the indicated times after the ADR addition ... addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate samples, and the bar represents the standard deviation Similar results...

Ngày tải lên: 19/02/2014, 06:20

13 494 0
Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf

... non-traditional export industries, whereas Japanese FDI has not The extremely short account of India’s reform program draws on Kumar (2003), Balasubramanyam and Mahambare (2003), Agrawal (2005) and Gupta ... sector appears to be concentrated in 27 For the importance of trade liberalization, financial liberalization and human capital formation as catalysts to more favorable growth effects of FDI, see Balasubramanyam ... Central Statistical Organisation (var iss.); Reserve Bank of India (Database on Indian Economy) 40 Table — FDI Characteristics, 1990-91 and 2002-03 Raw Memorandum Imports of materials, Value of...

Ngày tải lên: 21/02/2014, 01:20

45 514 0
Báo cáo "Correlation Effects in Atomic Thermal Vibration of fcc Crystals " pdf

Báo cáo "Correlation Effects in Atomic Thermal Vibration of fcc Crystals " pdf

... potential characterizing the interaction of each pair of atoms Numerical calculations have been carried out for Cu and Ni The calculated u , σ2 , CR functions and the ratio C R / u2 , C R / σ of ... terms of annihilation and creation operators, a and a , i e., ( ) ˆ ˆ y ≡ a0 a + a + , a0 = and use the harmonic oscilator state En = nhω0 E hω0 E , o 2keff (13) as the eigenstate with the eigenvalue ... 14(2004) 11 A Maradudin, E W Montroll, G H Weiss, and I P Ipatova, Theory of Lattice Dynamics in the Quadratic Approximation (Academic, New York, 1971) 12 J M Ziman, Principle of the Theory of Solids,...

Ngày tải lên: 05/03/2014, 14:20

8 412 0
Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas doc

Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas doc

... Analysis Data analyses included calculation of descriptive statistics and examination for multicollinearity, followed by non-spatial and spatial analyses For the non-spatial analyses, we examined ... Death rates for total non-cancer and kidney disease in rural areas that are not adjacent to metropolitan areas are higher in association with greater local and upstream toxicity-weighted water ... and dependent variables in a standard regression analysis may mask spatial variation in the relationships, such that the relationship may be strong in one part of the study area yet weak in another...

Ngày tải lên: 06/03/2014, 23:20

15 522 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... in MAO A R V Dunn et al Fig S5 Substrate dependence of the reductive halfreaction of MAO A- catalysed oxidation of PEA at pH 8.5 and 20 °C This material is available as part of the online article ... dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S3 Reaction transient for MAO A- catalysed oxidation of 0.5 mm PEA at pH 9.0 and 20 °C Fig S4 Reaction...

Ngày tải lên: 07/03/2014, 06:20

9 327 0
Báo cáo khoa học: Crosstalk between Src and major vault protein in epidermal growth factor-dependent cell signalling docx

Báo cáo khoa học: Crosstalk between Src and major vault protein in epidermal growth factor-dependent cell signalling docx

... immunoblotting was from Santa Cruz Biotechnology Inc (Santa Cruz, CA) Rabbit muscle enolase for in vitro Src kinase assay, anti-FLAG monoclonal antibody and anti-FLAG M2 agarose were from Sigma (St Louis, ... supernatants with glutathione–agarose beads (Pharmacia Biotech Inc., Piscataway, NJ) for h at °C, and the beads were washed three times with fresh TBS Stomach cancer tissue and normal stomach tissue ... calibration Delayed ion extraction resulted in peptide masses with better than 50 p.p.m mass accuracy on average Comparison of the mass values against the NCBInr database was performed using...

Ngày tải lên: 07/03/2014, 12:20

12 353 0
Programme Curriculum for Master Programme in Economic Growth, Innovation and Spatial Dynamics docx

Programme Curriculum for Master Programme in Economic Growth, Innovation and Spatial Dynamics docx

... evaluation and analysis of economic facts and ideas, and good communication skills Graduates of this programme are particularly equipped for analytical and planning work in government and international ... field of Economic Growth, Innovation and Spatial Dynamics, taking into account relevant scientific, social and ethical aspects, and demonstrate an awareness of ethical aspects of research and development ... history This part also introduces computer software (STATA or comparable) for quantitative analysis In the second part of the course, students analyze a quantitative problem using actual data from economic...

Ngày tải lên: 08/03/2014, 05:20

10 749 0
The Role of Education Quality in Economic Growth* pdf

The Role of Education Quality in Economic Growth* pdf

... increase in productive human capital as a year of schooling in Japan Additionally, this measure assumes that formal schooling is the primary (sole) source of education and, again, that variations ... to test a sample of adults and then to relate these measures to labor market experiences.19 An advantage of this data collection approach is that it provides information about the labor market ... conversation, acknowledge that a year of schooling in a school in a Brazilian Amazon village was not the same as a year of schooling in a school in Belgium They would also agree that families,...

Ngày tải lên: 08/03/2014, 08:20

96 776 1
A study in the growth mechanism of silicon nanowires with or without metal catalyst

A study in the growth mechanism of silicon nanowires with or without metal catalyst

... Metal-assisted growth of SiNWs A basic aspect of the VLS mechanism is the metal particle acting as a catalyst for the anisotropic growth of SiNW with a crystalline structure A catalyst particle ... very feasible to react with H2O (Eq (7)) The above factors easily cause a low-crystal quality of as-received SiNWs even amorphous SiO2 nanowires 3.3 Advantage and disadvantage of with and without ... was used, plenty of Si atoms will be flowed away and have no time to contact Fig A) Binary phase diagram of Au and Si B) A mode of VLS mechanism J.-J Niu, J.-N Wang / Materials Letters 62 (2008)...

Ngày tải lên: 16/03/2014, 15:09

5 577 0
Single electron effects in highly doped polysilicon nanowires

Single electron effects in highly doped polysilicon nanowires

... the drain current of the nanowires as a function of applied source–drain bias VSD , of a sidegate voltage VSG , of temperature T and of the magnetic ÿeld B Fig 3 (a) shows the conductance of a 25 ... grains are clearly visible An average diameter of these grains is determined to be about 25 nm The grain size increases both with longer annealing time as well as with higher annealing temperature ... wire The samples were then mounted into a chip-carrier, attached onto a sample holder and characterized in the chamber of a variable temperature insert (VTI) allowing temperatures in the range between...

Ngày tải lên: 16/03/2014, 15:21

5 203 0
Báo cáo khoa học: Cholinoceptive and cholinergic properties of cardiomyocytes involving an amplification mechanism for vagal efferent effects in sparsely innervated ventricular myocardium ppt

Báo cáo khoa học: Cholinoceptive and cholinergic properties of cardiomyocytes involving an amplification mechanism for vagal efferent effects in sparsely innervated ventricular myocardium ppt

... 5¢-ACAAGGAAGGATAGTGAAGCC-3¢; m2 (reverse), 5¢-CATCTCCATTCTGACCTGAAG-3¢; m5 (forward), 5¢-TCTGTTCAGATCCTGCTTG-3¢; m5 (reverse), 5¢-TGCTGGAGACAGAAGGTAGT-3¢; a3 (forward), 5¢CAGAGTCCAAAGGCTGCAAG-3¢; a3 ... filtered through a membrane filter with a molecular mass cut-off of 10 000 Da (UFC3LGC00; Millipore, Bedford, MA, USA) The filtrate was sampled for ACh assay A quantitative analysis of ACh was conducted ... and Labor Sciences research grants (H15-PHYSI-001, H16-NANO-005) from the Ministry of Health, Labor, and Welfare of Japan References Arikawa M, Katare RG, Kakinuma Y, Handa T, Ando M, Yamasaki...

Ngày tải lên: 23/03/2014, 05:22

15 386 0
w