Theoretical and experimental investigations of a downdraft biomass gasifierspark ignition engine power system

... THEORETICAL AND EXPERIMENTAL INVESTIGATIONS OF PASSIVE AND INTEGRATED ANTENNAS TAO YUAN M ENG, B ENG XIDIAN UNIVERSITY A DISSERTATION SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY OF ENGINEERING ... methods developed, a number of designs of integrated ultra-wideband antennas and fully integrated CMOS UWB transmitter modules were studied and results (si...

Ngày tải lên: 14/09/2015, 14:02

... paper, regarding NEMO and MANET, are also introduced, such as Multihoming, Route Optimization, and MANEMO 2.1 VANET Vehicular Ad hoc Networks (VANET) are a particular case of MANET, but they are ... in vehicular communications, there is an important lack of real evaluation analysis Many VANET solutions and protocols could be considered as nonpractical designs if they were...

Ngày tải lên: 21/06/2014, 08:20

... of engine parameters on performance and emissions of a pilot ignited natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and ... A2 T þ A3 T þ A4 T þ Þ ð5Þ [16] Mbarawa M, Milton BE, Casey RT Experiments and modeling of natural gas Cp ¼ð where (A0 ), (A1 ), (A2 ), (A3 ), and (A4 ) are con...

Ngày tải lên: 15/06/2014, 09:26

... supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel ... some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ester present react...

Ngày tải lên: 05/09/2013, 16:11

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... calculations Linking the Bank Lending Channel and the Disequilibrium Loan Market Analysis We assumed in our theoretical model of the bank lending channel that the loan interest rate is perfectly ... by the policymaker as a good indicator of attenuation and amplication effects of the bank lending channel Our analysis indicates that the b...

Ngày tải lên: 22/03/2014, 23:20

... conformity was assumed between liner's backside and acetabular shell inner-surface and between liner's frontside surface and femoral head In the actual acetabular components certain gaps are allowed ... constrained, assuming a rigid union between the acetabular shell and the acetabu- Figure head) involved in the Finite Element Model Contacting areas (Acetabular Shell/line...

Ngày tải lên: 20/06/2014, 00:20

... 8.3 36 Water+Cu Water+ Al2 O3 ϕ = 0.1 ϕ = 0.2 ϕ = 0.1 ϕ = 0.2 d = 0.4L 5.030 6. 591 4.974 6. 451 5.232 6. 667 5.153 6. 511 9.434 10.05 9.157 9.435 d = 0.5L 5.2 96 6.941 5.237 6. 793 5.571 7.051 5.481 6. 877 ... Methods for Heat Transfer Simulation Fast BEM Based Methods for Heat Transfer Simulation 211 studied turbulent heat transfer behaviour of nanofluid in a circular tub...

Ngày tải lên: 20/06/2014, 01:20

... devices, micro heat exchangers, micro valves and pumps, and lab-on-chips, more studies have been 80 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems dedicated ... 2007; Liu, 2004) 108 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems Resistance (Ω) 4e+5 3e+5 2e+5 1e+5 Temper...

Ngày tải lên: 21/06/2014, 02:20

... local Nusselt 144 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems numbers along the channel can be obtained and are presented in Figure 40 for different ... work and the published results for current channel with (a) 68.2 μm in height and (b) 23.7 μm in height 1 34 Heat Transfer - Theoretical Analysis, Experimental I...

Ngày tải lên: 21/06/2014, 02:20

... total heat flux input provided the heat flux to the liquid and the transient mean heat transfer coefficient 222 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems ... sonoluminescing gas bubbles The heat 2 06 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems bath bounda...

Ngày tải lên: 21/06/2014, 02:20

... have 262 262 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems developed ... fluids and heat flux control by regulating the electrical heating 264 264 Heat Transfer - Theoretical Analysis, Experimental Investigations...

Ngày tải lên: 21/06/2014, 02:20

... the heat transfer coefficient for pure steam with the increase in subcooling The condensation heat transfer 344 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems ... drop departs They clarified that the initial drop distance is closely related to the heat transfer 328 Heat Transfer - Theoretical Analysis, Experimental...

Ngày tải lên: 21/06/2014, 02:20

... electrochemical limiting current method 388 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems 10 hD x 10 m/s 10 100 100 0 Re • - this study, d = 1.5 mm, L = ... chapter application of the mass /heat transfer 380 Heat Transfer - Theoretical Analysis, Experimental Investigations and Industrial Systems analogy in...

Ngày tải lên: 21/06/2014, 02:20