molar mass and chemical formula of a volatile liquid

Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx

Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx

... FSA-3¢:5¢-GATAATT CCACACCCTCCAATTA-3¢; the internal standard was amplified with act.5¢:5¢-gcactgaagagcatccggtacttc-3¢ and act3¢:5¢-TGGGCACGGAATCTCAGC(TC)-3¢. The PCR programme was one cycle of 2 min at ... m M ,2lLdNTPs(10m M each), 0.5 lLeach primer 50 l M . CM-AAT1 was amplified by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢,andFSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was amplified with RSB-5¢ and FSA-3¢:5¢-GATAATT CCACACCCTCCAATTA-3¢; ... CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates. CM-AAT1 has the same enzyme activity as a strawberry SAAT characterized...

Ngày tải lên: 31/03/2014, 21:21

8 510 0
09 Physical and Chemical Characteristics of DDGS revisions.

09 Physical and Chemical Characteristics of DDGS revisions.

... effectiveness of including 2% calcium carbonate in DDGS as a User Handbook Physical & Chemical Characteristics of DDGS Physical & Chemical Characteristics of DDGS 08 - Physical & Chemical ... Physical & Chemical Characteristics of DDGS 1 Physical & Chemical Characteristics of U.S. DDGS Physical and chemical characteristics of distiller’s dried grains with solubles (DDGS) vary ... segregation during transport and handling – particle and ingredient segregation (separation) occurs when particles of different sizes and bulk densities are blended together and transported or handled....

Ngày tải lên: 08/08/2012, 10:03

8 749 0
Tài liệu PHYSICAL AND CHEMICAL ASPECTS OF ORGANIC ELECTRONIC doc

Tài liệu PHYSICAL AND CHEMICAL ASPECTS OF ORGANIC ELECTRONIC doc

... Chemistry Technical University of Dresden 01062 Dresden Germany Ralf Anselmann Evonik Industries Creavis Technology and Innovation Paul-Baumann-Straße 1 45764 Marl Germany Kannan Balasubramanian Max-Planck-Institute ... the ad- vantage that the deposition of the molecular material on a substrate is much more straightforward. Polymers at that stage are typically liquid and have – of course – a very low vapour ... Processability of Organic Compounds for Applications in Organic Electronics In general, for the realisation of OFETs two classes of materials are available: polymers and small molecules (so-called...

Ngày tải lên: 16/02/2014, 19:20

733 2,7K 1
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... homotetramers [4]. Gel filtration analysis of native HYD Js indicated a molecular mass of about 253 kDa, and, as the subunit molecular mass of the His-tagged recombinant HYD Js was estimated to...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, Germany). Trypsin and tosyl phenylalanyl ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely conotoxins, for defense and predation. Conotoxins are mainly ... of conotoxins and their analogs [24–27]. Most NOESY crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ ... oligomers 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl 2 , NaCl and mineral oil were obtained from Sigma (St Louis, MO, USA). Salmon testes DNA for the enzyme activity ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations ... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA Staphylococcal nuclease (SNase) is a...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... 2. Negative ion MALDI-TOF mass spectra of lipid A isolated from C. trachomatis serotype E (A) and L 2 (B) andfrom Chl. psittaci 6BC (C). Table 1. Fatty acid analysis of LPS from C. trachomatis ... particular at low concentrations. Discussion Members of the Gram-negative bacterial family Chlamydi- aceae cause diseases in man such as ocular trachoma and infections of the genitourinary tract ... intense peaks at m/z 1123.75 and 1137.74 of de-O-acylated lipid A of Chl. psittaci indicated that in this species (3-OH)-C21 : 0 was the most abundant amide-linked fatty acid. Analytical HPAEC and...

Ngày tải lên: 20/02/2014, 23:20

11 560 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... RTARAAYTGNCCNGCRTCYTG LP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTT LP7 AWAWALGWDDK LP8 GYHENA LP9 WPLDYFL F2 GCCACACTTCTGTCAACATCC 3RAC TTCTTCAAGGGCTGGCTCCCT 3AP CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR...

Ngày tải lên: 20/02/2014, 23:20

8 511 0
w