molar mass and chemical formula of a volatile liquid

Ngày tải lên: 21/06/2014, 02:20

... FSA-3¢:5¢-GATAATT CCACACCCTCCAATTA-3¢; the internal standard was amplified with act.5¢:5¢-gcactgaagagcatccggtacttc-3¢ and act3¢:5¢-TGGGCACGGAATCTCAGC(TC)-3¢. The PCR programme was one cycle of 2 min at ... m M ,2lLdNTPs(10m M each), 0.5 lLeach primer 50 l M . CM-AAT1 was amplified by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢,andFSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was amplified with RSB-5¢ and FSA-3¢:5¢-GATAATT CCACACCCTCCAATTA-3¢; ... CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates. CM-AAT1 has the same enzyme activity as a strawberry SAAT characterized...

Ngày tải lên: 31/03/2014, 21:21

Ngày tải lên: 22/07/2014, 03:20

Ngày tải lên: 13/08/2014, 14:20

Ngày tải lên: 14/08/2014, 13:22

... effectiveness of including 2% calcium carbonate in DDGS as a User Handbook Physical & Chemical Characteristics of DDGS Physical & Chemical Characteristics of DDGS 08 - Physical & Chemical ... Physical & Chemical Characteristics of DDGS 1 Physical & Chemical Characteristics of U.S. DDGS Physical and chemical characteristics of distiller’s dried grains with solubles (DDGS) vary ... segregation during transport and handling – particle and ingredient segregation (separation) occurs when particles of different sizes and bulk densities are blended together and transported or handled....

Ngày tải lên: 08/08/2012, 10:03

Ngày tải lên: 05/09/2013, 15:28

Ngày tải lên: 05/09/2013, 15:28

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 15/10/2013, 16:11

Ngày tải lên: 17/10/2013, 10:11

Ngày tải lên: 03/01/2014, 19:44

... Chemistry Technical University of Dresden 01062 Dresden Germany Ralf Anselmann Evonik Industries Creavis Technology and Innovation Paul-Baumann-Straße 1 45764 Marl Germany Kannan Balasubramanian Max-Planck-Institute ... the ad- vantage that the deposition of the molecular material on a substrate is much more straightforward. Polymers at that stage are typically liquid and have – of course – a very low vapour ... Processability of Organic Compounds for Applications in Organic Electronics In general, for the realisation of OFETs two classes of materials are available: polymers and small molecules (so-called...

Ngày tải lên: 16/02/2014, 19:20

... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... homotetramers [4]. Gel filtration analysis of native HYD Js indicated a molecular mass of about 253 kDa, and, as the subunit molecular mass of the His-tagged recombinant HYD Js was estimated to...

Ngày tải lên: 18/02/2014, 08:20

... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, Germany). Trypsin and tosyl phenylalanyl ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely conotoxins, for defense and predation. Conotoxins are mainly ... of conotoxins and their analogs [24–27]. Most NOESY crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations...

Ngày tải lên: 18/02/2014, 17:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ ... oligomers 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse). BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

... Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl 2 , NaCl and mineral oil were obtained from Sigma (St Louis, MO, USA). Salmon testes DNA for the enzyme activity ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations ... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA Staphylococcal nuclease (SNase) is a...

Ngày tải lên: 20/02/2014, 01:20

... 2. Negative ion MALDI-TOF mass spectra of lipid A isolated from C. trachomatis serotype E (A) and L 2 (B) andfrom Chl. psittaci 6BC (C). Table 1. Fatty acid analysis of LPS from C. trachomatis ... particular at low concentrations. Discussion Members of the Gram-negative bacterial family Chlamydi- aceae cause diseases in man such as ocular trachoma and infections of the genitourinary tract ... intense peaks at m/z 1123.75 and 1137.74 of de-O-acylated lipid A of Chl. psittaci indicated that in this species (3-OH)-C21 : 0 was the most abundant amide-linked fatty acid. Analytical HPAEC and...

Ngày tải lên: 20/02/2014, 23:20

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... RTARAAYTGNCCNGCRTCYTG LP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTT LP7 AWAWALGWDDK LP8 GYHENA LP9 WPLDYFL F2 GCCACACTTCTGTCAACATCC 3RAC TTCTTCAAGGGCTGGCTCCCT 3AP CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR...

Ngày tải lên: 20/02/2014, 23:20