define vapor pressure and boiling point of a liquid

Ngày tải lên: 02/06/2014, 15:10

Ngày tải lên: 13/08/2014, 08:20

Ngày tải lên: 05/09/2013, 15:28

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 15/10/2013, 16:11

Ngày tải lên: 17/10/2013, 10:11

Ngày tải lên: 03/01/2014, 19:44

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... Metab Dispos 2, 103–112. 11 Moller A, Syldatk C, Schulze M & Wagner F (1988) Stereo- and substrate-specificity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter...

Ngày tải lên: 18/02/2014, 08:20

... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, Germany). Trypsin and tosyl phenylalanyl ... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely conotoxins, for defense and predation. Conotoxins are mainly ... of conotoxins and their analogs [24–27]. Most NOESY crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations...

Ngày tải lên: 18/02/2014, 17:20

... 5Â-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3Â and a reverse oligomer 5Â-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3Â. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 Â-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3Â and the reverse oligomer 5Â-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3Â ... oligomers 5Â-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3Â (forward) and 5Â-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3Â (reverse). BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

... Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl 2 , NaCl and mineral oil were obtained from Sigma (St Louis, MO, USA). Salmon testes DNA for the enzyme activity ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183. 15 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations ... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC 3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA Staphylococcal nuclease (SNase) is a...

Ngày tải lên: 20/02/2014, 01:20

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... RTARAAYTGNCCNGCRTCYTG LP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTT LP7 AWAWALGWDDK LP8 GYHENA LP9 WPLDYFL F2 GCCACACTTCTGTCAACATCC 3RAC TTCTTCAAGGGCTGGCTCCCT 3AP CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR...

Ngày tải lên: 20/02/2014, 23:20

... Chicester. 32. Mu ă hlradt, P.F. & Frisch, M. (1994) Purification and partial bio- chemical characterization of a Mycoplasma fermentans-derived substance that activates macrophages to release nitric oxide, tumor ... confers interspecies variation of a major surface lipoprotein and a macrophage-activating lipopeptide of Mycoplasma fermentans. Infect. Immunol. 67, 760–771. 34. Takeuchi, O., Kaufmann, A. , Grote, K., Kawai, T., ... mechanical disturbance leading to a conformational change of the protein and, with that, signal transduction. Recently, Ben-Menachem 3 et al. [45] presented a physico- chemical characterization of...

Ngày tải lên: 21/02/2014, 00:20

... isolation and charac- terization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have made a comparative analysis of the ... synthesized chemically and preliminary studies on antibacterial activity showed that the quality and biological activity of native and synthesized toxins were identical. Due to a shortage of native material, all ... [20], parabutoporin and opistoporin 1 were tested on Gram- negative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1). Parabutoporin...

Ngày tải lên: 21/02/2014, 15:20

... of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... waters. As coastal aquaculture systems are located mainly in sheltered coastal waters of the Straits of Malacca, these agricultural wastes, carrying bacteria and heavy metals, can be a health...

Ngày tải lên: 06/03/2014, 15:21

... L, Hamid Q & Elias JA (2004) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678– 1682. 4 Kasprzewska A (2003) Plant chitinases ) regulation ... increase of antifungal function. Biosci Biotech Biochem 66, 1084–1092. 35 Kawase T, Yokokawa S, Saito A, Fujii T, Nikaidou N, Miyashita K & Watanabe T (2006) Comparison of enzymatic and antifungal ... equal amounts of (GlcNAc) 3 and (GlcNAc) 2 ; the 80 : 20 anomeric ratio of the products indicates that cleavage after sugar 2 or sugar 3 occurs approxi- mately equally often. Structure The overall...

Ngày tải lên: 07/03/2014, 11:20

... The remaining 495 amino acids are considered to constitute the lac1 mature protein giving a calculated molecular mass of 53 212 Da. Two putative polyadenylation signals (TATAAA and CATAAA) were identied ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °C for 10 min. The primers for lac1 P LAC1F (5Â-AGCTTT CATTCCCAGTGATTG-3Â)andP LAC1R (5Â-AACGAG CTCAAGTACAAATGACT-3Â) ... Stimulation of laccase production by Fig. 6. Transcription analysis of lac1 by RT-PCR (A) and total laccase activity (B) during various stages of V. volvacea fruitbody development. mRNA was extracted...

Ngày tải lên: 07/03/2014, 15:20

... 5Â-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3Â. b-Actin primers were designed as follows: forward 5Â-CTACAATGAGCTGCG TGT-3Â and reverse 5Â-AAGGAAGGCTGGAAGAGT-3 ¢. Cell survival and apoptosis analysis For viability ... contain a KH domain. RNA analysis and blast analysis indicated that homologs and orthologs of VBARP exist, indica- ting the presence of VBARP in diverse phyla such as plants, yeast, and eukaryotes. ... (predictprotein: http://www.cubic.bioc.columbia.edu/predictprotein). RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from human tissues and human primary cells using Qiagen RNA purification kit (Qiagen, Valencia, CA) and used in real-time...

Ngày tải lên: 07/03/2014, 21:20

... of the ORF and contained a SalIsite(5Â-CTACGTCGACGATGGCGAA CATCTGGCCACGAATC-3Â); the reverse primer corres- ponded to the 3Â-end of the ORF and contained an XbaIsite (5Â-AGGCTCTAGATTTATGAGAAATTGGCTTTCTG GAC-3Â). Expression ... post-treatment. The poly (A) -RNA was extracted from the larvae, and 300 ng mRNA of each sample was loaded on a gel. Actin mRNA served as an internal marker to equate mRNA quantities. Fig. 9. Alignment ... DIG Labelling Mix (Roche). To prepare a DmEH probe, primers (5Â-ATGGCGAAC ATCTGGCCACGAATC-3Â and 5Â-TTATGAGAAATT GGCTTTCTGGAC-3Â) were used, and to prepare Actin 5C probe as an internal marker,...

Ngày tải lên: 07/03/2014, 21:20

... switch point between agonist and antagonist structures [21–23]. By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b 2 -HAla-NHMe and Ac-b 3 -HAla- NHMe have been generated and ... acid-substituted SP analogues [HGly9]SP, [b 2 -HAla9]SP and [b 3 -HAla9]SP may adopt conforma- tions around residue 9 that are analogous to those adopted by a- amino acids (Gly, Ala, Sar, Pro). To explain the ... varying /, w angles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10°.Each/, h,andw-value was fixed by applying a harmonic potential and the structures were minimized (adiabatic...

Ngày tải lên: 08/03/2014, 08:20