define vapor pressure and boiling point of a liquid
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... molecular basis of enzyme thermosta-bility. J Bacteriol 185, 4038–4049.20 Nanba H, Yajima K, Takano M, Yamada Y, IkenakaY & Takahashi S (1997) Process for producing d-N-car-bamoyl -a- amino acid. ... molecular masswas also estimated by SDS–PAGE.Characterization and comparative analyses of HYDJs and HYDBpThe optimal temperature for activity of HYDJswith d-p-HPH as substrate was determined ... Metab Dispos 2,103–112.11 Moller A, Syldatk C, Schulze M & Wagner F (1988)Stereo- and substrate-specificity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter...
- 14
- 621
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms-tadt, Germany). Trypsin and tosyl phenylalanyl ... 2008)doi:10.1111/j.1742-4658.2008.06352.xCone snails, a group of gastropod animals that inhabit tropical seas, arecapable of producing a mixture of peptide neurotoxins, namely conotoxins,for defense and predation. Conotoxins are mainly ... of conotoxins and their analogs [24–27].Most NOESY crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5Â-CTTTATTTTCAGGGCGCCATGAAGCGCGCAAGACCGTCTGAA-3Â and a reverse oligomer 5Â-AGCTCGAATTCG GATCCGGTACCTCAGAAGGTAGACAGCAGAACC-3Â. For derivitization with TMR, a Gly-Gly-Cyssequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site.The forward o ligomer 5 Â-TCCGAAACCAGCG GCCGCTTTATCGCGTTA AAAC CGGT GATCAA ACCCC -3Â and thereverse oligomer 5Â-GTAGGCCTT TGAATTCCTCAAAAAGTGCGGCTCGAT-3Â ... oligomers5Â-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAATTCGAG-3Â (forward) and 5Â-GCTCGAATTCGGATCAGCAACCTCCAAAGGTAGACAGCA-3Â (reverse). BL21cells were transformed with the pETM11 construct and grown until a D of 0.8...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... Salmon testesDNA and some analytical grade chemicals such as EDTA,Tris ⁄ HCl, CaCl2, NaCl and mineral oil were obtained fromSigma (St Louis, MO, USA). Salmon testes DNA for theenzyme activity ... folding pathway: structure-based analysis of staphylococcal nuclease. Proteins: Structure, Function and Genetics 27, 171–183.15 Flanagan JM, Kataoka M, Fujisawa T & EngelmanDM (1993) Mutations ... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USAStaphylococcal nuclease (SNase) is a...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR...
- 8
- 511
- 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... Chicester.32. Muăhlradt, P.F. & Frisch, M. (1994) Purification and partial bio-chemical characterization of a Mycoplasma fermentans-derivedsubstance that activates macrophages to release nitric oxide,tumor ... confersinterspecies variation of a major surface lipoprotein and a macrophage-activating lipopeptide of Mycoplasma fermentans.Infect. Immunol. 67, 760–771.34. Takeuchi, O., Kaufmann, A. , Grote, K., Kawai, T., ... mechanicaldisturbance leading to a conformational change of theprotein and, with that, signal transduction.Recently, Ben-Menachem3et al. [45] presented a physico-chemical characterization of...
- 9
- 665
- 1
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... isolation and charac-terization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southernAfrica, and we have made a comparative analysis of the ... synthesizedchemically and preliminary studies on antibacterial activityshowed that the quality and biological activity of native and synthesized toxins were identical. Due to a shortage of native material, all ... [20],parabutoporin and opistoporin 1 were tested on Gram-negative and Gram-positive bacteria and their activity wascompared with the activity of melittin and mastoparan(Table 1).Parabutoporin...
- 12
- 598
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... waters. As coastal aquaculture systems are located mainly in sheltered coastal waters of the Straits of Malacca, these agricultural wastes, carrying bacteria and heavy metals, can be a health...
- 88
- 581
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... L, Hamid Q & Elias JA (2004) Acidicmammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678–1682.4 Kasprzewska A (2003) Plant chitinases ) regulation ... increase of antifungal function.Biosci Biotech Biochem 66, 1084–1092.35 Kawase T, Yokokawa S, Saito A, Fujii T, Nikaidou N,Miyashita K & Watanabe T (2006) Comparison of enzymatic and antifungal ... equal amounts of (GlcNAc)3 and (GlcNAc)2;the 80 : 20 anomeric ratio of the products indicatesthat cleavage after sugar 2 or sugar 3 occurs approxi-mately equally often.StructureThe overall...
- 12
- 399
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... The remaining 495 amino acids areconsidered to constitute the lac1 mature protein giving a calculated molecular mass of 53 212 Da. Two putativepolyadenylation signals (TATAAA and CATAAA) wereidentied ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °Cfor 10 min. The primers for lac1 PLAC1F(5Â-AGCTTTCATTCCCAGTGATTG-3Â)andPLAC1R(5Â-AACGAGCTCAAGTACAAATGACT-3Â) ... Stimulation of laccase production byFig. 6. Transcription analysis of lac1 by RT-PCR (A) and total laccaseactivity (B) during various stages of V. volvacea fruitbody development.mRNA was extracted...
- 11
- 703
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... 5Â-CTAGACTCGAGCCTAATTTATATTTGCTCCTTGTGC-3Â. b-Actin primers weredesigned as follows: forward 5Â-CTACAATGAGCTGCGTGT-3Â and reverse 5Â-AAGGAAGGCTGGAAGAGT-3 ¢.Cell survival and apoptosis analysisFor viability ... contain a KHdomain. RNA analysis and blast analysis indicatedthat homologs and orthologs of VBARP exist, indica-ting the presence of VBARP in diverse phyla such asplants, yeast, and eukaryotes. ... (predictprotein:http://www.cubic.bioc.columbia.edu/predictprotein).RNA extraction and quantitative real-timeRT-PCRTotal RNA was extracted from human tissues and humanprimary cells using Qiagen RNA purification kit (Qiagen,Valencia, CA) and used in real-time...
- 12
- 561
- 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
... of the ORF and contained a SalIsite(5Â-CTACGTCGACGATGGCGAACATCTGGCCACGAATC-3Â); the reverse primer corres-ponded to the 3Â-end of the ORF and contained an XbaIsite(5Â-AGGCTCTAGATTTATGAGAAATTGGCTTTCTGGAC-3Â).Expression ... post-treatment. The poly (A) -RNA was extracted from thelarvae, and 300 ng mRNA of each sample was loaded on a gel. ActinmRNA served as an internal marker to equate mRNA quantities.Fig. 9. Alignment ... DIG Labelling Mix (Roche). Toprepare a DmEH probe, primers (5Â-ATGGCGAACATCTGGCCACGAATC-3Â and 5Â-TTATGAGAAATTGGCTTTCTGGAC-3Â) were used, and to prepare Actin5C probe as an internal marker,...
- 10
- 378
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... switch point between agonist and antagonist structures [21–23].By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAla-NHMe have been generated and ... acid-substituted SP analogues [HGly9]SP,[b2-HAla9]SP and [b3-HAla9]SP may adopt conforma-tions around residue 9 that are analogous to thoseadopted by a- amino acids (Gly, Ala, Sar, Pro). To explainthe ... varying /, wangles in intervals of 10° and setting h angle to ) 60 ± 10° and 60 ± 10°.Each/, h,andw-value was fixed by applying a harmonic potential and the structures were minimized(adiabatic...
- 11
- 860
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25