define the terms vapor pressure and boiling point of a liquid

Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf

Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf

... provides a rationale for assuming maturational delay. The Panel further notes that LOAELs of 500 and 200 mg/kg bw/day and NOAELs of 100 and 40 mg/kg bw/ day from these studies are reasonably consistent, ... widespread public concern about the safety of phthalates. As part of the evaluation of phthalates, the CERHR convened a panel of scientic experts (Appendix I) to review, discuss, and evaluate the ... observed at gestational doses of 127–151 mg/kg bw/day and higher and a lactational dose of 166−377 mg/kg bw/day and higher; the developmental NOAEL is in the range of 38–44 mg/kg bw/day (gestational)...

Ngày tải lên: 13/02/2014, 10:20

147 859 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

... of the hydrolysis was confirmed by the disappearance of the (Met1)-ONC (M23L) signal in the MALDI-TOF mass spectra 1 h after the addition of AAP. The pH was adjusted to 2.5, 8.0 and 11.5 and the ... Nitta, K., Kawauchi, H., Takayanagi, Y. & Oyama, F. (1991) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeiana and R. japonica and liver ribonuclease ... occurs in the pH range 8.0–8.5 [23]. When evaluating the influence of Table 2. Thermodynamic parameters of the thermal denaturaturation of the different onconase (ONC) variants at 25 C and pH 2.0....

Ngày tải lên: 19/02/2014, 12:20

9 705 0
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx

... quantitative measurement of the activity of GABA- uptake, an aliquot of the stable CHO transfectants was used for GABA-uptake assay, and another aliquot was used to determine the quantity of ... 1631 The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter Guoqiang Cai 1,2 , ... were analyzed on the basis of the MichaelisMenten equation V V max GABA ẵGABA K m GABA ỵẵGABA and the parameters for NNN with and without treat- ment with dMM, and for N-glycosylation mutant DDN...

Ngày tải lên: 19/02/2014, 17:20

14 655 0
Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

... among plants and cyanobacteria, the surface charge pattern varies greatly [1]. Comparing cyanobacterial data with the wealth of information available for the higher plant reaction [2–5] reveals ... in cyanobacteria and algae: an instance of unusual genetic-vari- ability. Biochim. Biophys. Acta 766, 310–316. 7. Balme, A. , Herva ´ s,M.,Campos,L .A. ,Sancho,J.,DelaRosa, M .A. & Navarro, J .A. ... charge. The same analysis has been used for the interaction between Cyt f and plastocyanin [1], and for an in-depth discussion of the advantages and limitations of the Watkins model the reader...

Ngày tải lên: 21/02/2014, 01:21

10 674 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

... described the isolation and charac- terization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have made a comparative analysis ... melittin and mastoparan gave the same results. The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg 2+ on the activity of the peptides against Gram-positive ... [20], parabutoporin and opistoporin 1 were tested on Gram- negative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1). Parabutoporin...

Ngày tải lên: 21/02/2014, 15:20

12 598 0
NTP-CERHR MONOGRAPH ON THE POTENTIAL HUMAN REPRODUCTIVE AND DEVELOPMENTAl EFFECTS OF BISPHENOL A pot

NTP-CERHR MONOGRAPH ON THE POTENTIAL HUMAN REPRODUCTIVE AND DEVELOPMENTAl EFFECTS OF BISPHENOL A pot

... such as diethylstilbestrol, leads to squamous metaplasia of the prostate, a tissue change characterized by a multilayering of pros- tatic basal epithelial cells. Squamous metaplasia is associated ... estradiol has a clearer role in regulating male-typical brain and behavioral sexual differentiation in rodents compared to primates and humans. The sexual dimorphism of a number of the neural ... affected by the background incidence, e.g., tumor or malformation rates in control animals, variability of a particular end- point, and the magnitude of the effect. A sample size of at least...

Ngày tải lên: 05/03/2014, 16:20

321 1,5K 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... tidal stream of over 4 knots. The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges from a...

Ngày tải lên: 06/03/2014, 15:21

88 583 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... standard assay mixtures, the velocity of ABTS oxidation was maximal at 45 °C. The dependence of the rate of ABTS oxidation by lac1 on substrate concentration at pH 3.0 and 45 °C followed Michaelis–Menten ... cycles of 94 °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °C for 10 min. The primers for lac1 P LAC1F (5Â-AGCTTT CATTCCCAGTGATTG-3Â)andP LAC1R (5Â-AACGAG CTCAAGTACAAATGACT-3Â) ... product abundance was evaluated in the exponential phase of the reaction (half of the maximum product). To further validate the assays, the optimized cycle number (23 and 28 for gpd and lac1, respectively)...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

... reviewer. M .A. Toscano acknowledges the assistance of R.P. Stumpf (NOAA/National Ocean Service) and K.S. Casey (NOAA/National Oceanographic Data Center) with SST data and climatology processing, and K. ... approach was used to analyze the quadrat data. Counts from the quadrats were pooled to obtain mean estimates of the abundance of juvenile corals and, separately, the abundance of E. viridis for each ... (Balistidae), the jolthead porgy Calamus bajonado (Sparidae), and the hogfish Lachnolaimus maximus (Labridae) – were 436 Ag. tenuifolia was 50%; Aronson and Precht 1997), March 1999, February 2000, and...

Ngày tải lên: 07/03/2014, 17:20

13 583 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... a KH domain. RNA analysis and blast analysis indicated that homologs and orthologs of VBARP exist, indica- ting the presence of VBARP in diverse phyla such as plants, yeast, and eukaryotes. These ... repetitions of the yeast two-hybrid assay and using a mammalian hybrid system (Invitrogen, Carlsbad, CA) (EDA Wheeler & V Ayyavoo, unpublished data). A blast search revealed that the IMAGE clone, ... VBARP-L consisted of a 576-bp fragment absent from the shorter VBARP-S and contained a 114-bp UTR (Fig. 2A) . Intron and exon analysis of VBARP revealed that VBARP-L and VBARP-S con- tain 11 and...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... the adjacent Phe8 Fig. 2. (/ – w)mapsofb-amino acids with indication of the conformational space common with that of a- amino acids. The (/ ) w)maps corresponding to h-values of )60° and 60° are indicated ... procedures Molecular mechanics calculations N-acetyl NÂ-methyl amide derivatives of HGly, b 2 -HAla and b 3 -HAla and of a- amino acids were built using INSIGHTII (Accelrys Inc.). Molecular mechanics calculations ... the torsion angles /, h and w. For the b 2 and b 3 -amino acid substi- tuted-SP analogues, the methyl side chain of b-HAla exhibits the same orientation as the one in [Ala9]SP (CIP’s rule a- amino...

Ngày tải lên: 08/03/2014, 08:20

11 861 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

... coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation. Identification of the active isoform Because of disulfide scrambling ... deaths occur annually, making measles the most important cause of infant mortality worldwide. The low vaccine coverage and the low vaccine efficacy in the presence of maternal antibodies are major ... during an association time of 180 s and a dissociation time of 120 s at a constant ow rate of 20 lLặmin )1 at 25 C. The signal of the control canal with the irrelevant peptide was subtracted from the corresponding...

Ngày tải lên: 08/03/2014, 08:20

13 492 0
Báo cáo khoa học: Pressure and heat inactivation of recombinant human acetylcholinesterase Importance of residue E202 for enzyme stability pdf

Báo cáo khoa học: Pressure and heat inactivation of recombinant human acetylcholinesterase Importance of residue E202 for enzyme stability pdf

... side-chains strengthened heat or pressure stability. The mutation E45 0A and the sextuple mutation caused destabilization of the enzyme to pressure. Thermal inactivation data on mutants showed that all of them ... at P 0 and 25 °C for the same periods of time (t), providing the control activity a 0 at t 0 and the residual activity a t at time t. The relative activity of AChE at P 0 and 25 °Cfor the period of ... incubation of the partially denatured AChE, at 27 °C (data not shown). Table 2 depicts k d values of inactivation at 55 °C. The k d value of the E45 0A mutant is more than 10-fold lower than that of...

Ngày tải lên: 08/03/2014, 10:20

11 311 0
Báo cáo " Calculation of Lindemann’s melting Temperature and Eutectic Point of bcc Binary Alloys " pot

Báo cáo " Calculation of Lindemann’s melting Temperature and Eutectic Point of bcc Binary Alloys " pot

... on the vertex and one atom in the center of the bcc are localized in an elementary cell. Hence, the total number of atoms in an elementary cell is 2. Then if on average s is atomic number of ... linearly proportional to the temperature T. Therefore, at a given temperature T the quantity R defined by the ratio of the RMSF in atomic positions about the equilibrium lattice positions and the ... equilibrium lattice positions and the nearest neighbor distance reaches a critical value. Hence, the lattice thermodynamic theory is one of the most important fundamentals for interpreting thermodynamic...

Ngày tải lên: 14/03/2014, 13:20

8 355 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA). The primers used were: 5Â-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 Â (forward, the mutagenesis codon underlined) and 5Â-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3Â ... of degradative enzymes, such as the alkaline protease aprE, at the tran- scriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/). A ... was supported by the University of Padua and by the Italian Ministry for Research (COFIN 2007). Table 1. Statistics on data collection and refinement. A wavelength of 0.9794 A ˚ was used. A charge-coupled...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
w