Cinque, g1 adverbs and functional heads

... females Fig Ability to perform ADL Analysis by gender Tlie Ceylon Journal of Medical Science Physical health and functional ability of an elderly population in Sri Lanka 13 Table Number and % (in parenthesis) ... Identification of health problems and functional ability of an elderly population is of importance to health planners and policy make...

Ngày tải lên: 14/02/2014, 06:20

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...

Ngày tải lên: 18/02/2014, 12:20

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level...

Ngày tải lên: 18/02/2014, 14:20

... mgÆmL) 1) and 3.2 lL Na125I (100 mCiÆmL) 1) were added to lL peptide solution (1 lgÆlL) 1); 15 lL sodium bisulfite (2.75 mgÆmL) 1) and 50 lL NaI (0.16 m) were added after of reaction at 18 °C The radiolabelled ... identification of the presence of the Rv2560 proline- and glycine-rich transmembrane protein encoding gene and its transcripts in the M tuberculosis c...

Ngày tải lên: 18/02/2014, 16:20

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...

Ngày tải lên: 18/02/2014, 18:20

... Consensus Globin ⁄ DHP Ar marina A2 Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron ... marina Hb Intra Mb G dibranchiata mIV A ornata DHP CDS Intron Intron CDS Intron Intron Intron Intron Intron Intron Intron Intron Intron Intron CDS Intron Intron CDS Intron Intron Intron...

Ngày tải lên: 19/02/2014, 02:20

... vector MS fragmentations of entries A and B are shown in the lower panel CYP93E1 has 24-hydroxylase activities for both b-amyrin and sophoradiol substrates b-amyrin and sophoradiol hydroxylase ... production of not only flavonoid but also of triterpene saponins is induced by elicitation as mentioned above, triterpene hydroxylase is one possible function of CYP93E1 Fee...

Ngày tải lên: 19/02/2014, 07:20

... PDGF-C and -D, structure and function L J Reigstad et al endothelial growth factors (VEGF) and the family is therefore often referred to as the PDGF ⁄ VEGF family The PDGF family of growth factors ... however further understanding of how these factors interplay with other members of the cystine knot family and in particular the PDGF-A, -B, and V...

Ngày tải lên: 19/02/2014, 07:20

... added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢) Amplification was performed ... markers were supplied by Sigma Aldrich (Milan, Italy) Reagents for bacterial growth were purchased from Fluka (Milan, Italy) T4 DNA ligase and Taq polymerase were from Stratagene (La J...

Ngày tải lên: 19/02/2014, 07:20

... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...

Ngày tải lên: 21/02/2014, 00:20

... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively...

Ngày tải lên: 21/02/2014, 03:20