Recovery of antibiotic resistance genes in natural environments
... EDTA LB Luria-Bertani P:C:IAA Phenol:Cloroform:isoamylalcohol MIC Minimum inhibitory concentration Recovery of antibiotic resistance genes in natural environments Abstract: Recently environmental ... canal in Ho Chi Minh city For screening antibiotic resistant E.coli strains bearing recombinant pUC19 plasmids, common antibiotics such as gentamicin, tetracycline, chloramphe...
Ngày tải lên: 28/05/2016, 14:41
... presence of C2H2 The denitrifying fungi predominantly produced N2O as the final product as well as those of pure strains The denitrifying bacteria produced N2O as a transient intermediate and the final ... enrich denitrifying fungi All bacteria and fungi not have denitrification activities Consequently, species and strains of denitrifying fungi were not identified,...
Ngày tải lên: 05/09/2013, 08:40
... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...
Ngày tải lên: 12/08/2014, 03:20
real situation of antibiotic resistance in pneumonia in việt nam and guideline for initial antibiotic treatment
... HAP Working Group Am J Infect Control 2008;36:S83-92 HCAP , HAP Guidelines VN guidelines for the management of lower respiratory infections -2013 Importance of initial empiric antibiotic treatment ... ampicillin/sulbactam) Cephalosporins (2nd or 3rd generation) Fluoroquinolones (levofloxacin, moxifloxacin) Fluoroquinolones (ciprofloxacin, levofloxacin - high dose) or βlactam with...
Ngày tải lên: 01/12/2014, 14:58
Tài liệu Báo cáo khoa học: The molecular surface of proteolytic enzymes has an important role in stability of the enzymatic activity in extraordinary environments pptx
... mutations at these positions in Sendai should promote instability of the surface region As the C region of Sendai also would play an important role in restraining the conformational change of the surface ... temperature indicates the stability of the structure of the protein The difference of the increments between the inactive temperature and...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Báo cáo khoa học: "The Use of Ooject-Special Knowledge in Natural Language Processing" doc
... of active tokens (a part of snort term memory) for any containers that might b e expected to contain the substance moved, in this case wine This is done by applying two tests to the objects In ... only when the objects in the text are described in a manner that indicates they are being used functionally In addition, no more than one or two levels of forward o r backward Infere...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... survey of missing enzymes in the KEGG PATHWAY database suggests that the lysine-degradation pathway map for P aeruginosa is missing 28 of its 62 enzymes (45%) Lysine catabolism is notable for ... that there are multiple known enzyme genes around a target pathway hole as A ¼ {a1 ,a2 , ,a| A|}, where |A| is the number of known enzyme genes that are adjace...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-specific expression may account for retention of these duplicated genes in the zebrafish (Danio rerio) genome docx
... Variations in the residues involved in the binding at site of the human FABP1, and possibly in zebrafish FABP1a and zebrafish FABP1b, may reflect differences in the binding affinities of the zebrafish ... during embryogenesis and therefore may not perform a function equivalent to mammalian FABP1 during zebrafish embryogenesis The distinct patterns of ex...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Structure of amyloid b fragments in aqueous environments docx
... conformations of < /b> other Ab fragments, including fulllength Ab The two most abundant forms of < /b> Ab are the 40 and 42 residue peptides, Ab1)40 and Ab1)42 Both forms are capable of < /b> assembling into b- sheet fibrils ... analysis in aqueous solutions In APP, Ab1)28 is in the extracellular domain and Ab29)42 is in the transmembrane domain [35] Structural analysis of < /...
Ngày tải lên: 07/03/2014, 12:20
ENVIRONMENTAL IMPACT OF HEAVY METAL POLLUTION IN NATURAL AQUATIC SYSTEMS ppt
... distribution of heavy metals between soil and soil solutions is a key issue in evaluating the environmental impact of long term applications of heavy metals to land Contamination of soils by heavy metals ... ROLE OF HYDROUS METAL OXIDES IN THE TRANSPORT OF HEAVY METALS IN THE ENVIRONMENT Introduction Sources of Hydrous Metal Oxides in the Aquatic Enviro...
Ngày tải lên: 23/03/2014, 00:20
Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot
... Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness (Abstract) Catherine E Beck Polymer applications have become more demanding as industry continuously ... “accelerated to a desired rotation rate.”16 Spinning continued until an equilibrium film thickness was reached This was followed by annealing to alleviate radial...
Ngày tải lên: 23/03/2014, 01:20
Báo cáo khoa học: Microarray analyses of hypoxia-regulated genes in an aryl hydrocarbon receptor nuclear translocator (Arnt)-dependent manner ppt
... than 1.5-fold induction in BpRc1 cells, suggesting that these genes were induced by hypoxia in an Arnt-dependent manner The remaining 24 genes demonstrated a greater than 1.5fold induction in ... b-dependent manner Q-PCR analyses confirmed that nine genes were induced and four were repressed in response to hypoxia (Tables and 4), and that 10 of the 13 confirmed genes w...
Ngày tải lên: 23/03/2014, 06:20
Review of the Existing Techniques for the Determination of Dry Rubber Content in Natural potx
... presented in this thesis In this thesis, results of our work on the design and development of different instrumentation systems for the rapid determination of Dry Rubber Content in natural rubber ... discussion of the results are included in chapter five of this thesis Finally, in chapter six the summary and general conclusions of the work includi...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: Genome-wide identification of glucosinolate synthesis genes in Brassica rapa potx
... et al Glucosinolate biosynthesis genes in Brassica rapa Fig Biosynthesis pathways of the three major groups of glucosinolates in B rapa The genes involved in each step are shown Numbers in parenthesis ... expression of Arabidopsis glucosinolate synthesis genes altered the glucosinolate profile in Chinese cabbage [50,51] Because most of the Arabidopsis gen...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc
... (between and 24 h) used by the authors In another study, 258 differentially expressed genes were identified in C gigas in response to exposure to hydrocarbons for and 21 days [22], and some of these genes ... among the down -regulated genes Expression of herbicide -regulated genes The time-dependent expression of 13 genes that were up -regul...
Ngày tải lên: 30/03/2014, 15:20