A level physics 1 force and motion

Tài liệu Chapter 6: Force and Motion II docx

Tài liệu Chapter 6: Force and Motion II docx

... existence of a new force f s which r balances the force F with which we push the crate This force is called the static frictional force As we increase F , f s also increases and the crate remains ... F = r This force is known as “centripetal force The notion of centripetal force may be confusing sometimes A common mistake is to “invent” this force out of thin air Centripetal...

Ngày tải lên: 13/12/2013, 05:15

10 503 0
Tài liệu Chapter 5: Force and Motion pdf

Tài liệu Chapter 5: Force and Motion pdf

... several forces act on a body (say FA , FB , and FC ) the net force Fnet r r r r r r r r is defined as: Fnet = FA + FB + FC i.e Fnet is the vector sum of FA , FB , and FC Force: The concept of force ... application of a force F The force is adjusted so that a = m/s2 We then say that F = newton (symbol: N) Note: If several forces act on a body r r r r (say FA , FB , and FC ) the...

Ngày tải lên: 13/12/2013, 05:15

12 506 0
Neural network adaptive force and motion control of robot manipulators in the operational space formulation

Neural network adaptive force and motion control of robot manipulators in the operational space formulation

... presents the review of the existing adaptive control works as follows: the joint space direct LIP adaptive control, the operational space direct LIP motion control and the original joint space NN ... element of the link mass, three elements of the first moments (by product of the link mass times the coordinates of the center -of- mass), six el...

Ngày tải lên: 14/09/2015, 08:50

226 660 0
English Language Tests-Intermediate level''''s archiveMagical Words and Phrases (1)1.A ......... is potx

English Language Tests-Intermediate level''''s archiveMagical Words and Phrases (1)1.A ......... is potx

... 2.A is usually a woman who practices black or evil magic and is very familiar with witchcraft These women often wear large, black hats and are sometimes referred to ... feel sick and queasy Do you believe in sorcery and spells? threw cast chucked blew 4.In mythical books and movies, witches usually fly around on broomsticks mops dusters vacuums 5.A is similar ... granted the...

Ngày tải lên: 25/07/2014, 07:20

9 356 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

... comparable study of visually-induced motion sickness We were especially interested in replicating and extending research by Drummond and Granston that showed that visually-induced motion sickness in ... herein extends this line of research by combining a visual motion sickness- inducing stimulus with pain and pre-treatment with rizatriptan In this study, r...

Ngày tải lên: 26/10/2012, 09:57

6 504 0
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

... by information about the participants The study implementation is outlined along with information about data collection instruments used Finally, details of the nature of the data this study has ... is a reason why the Ministry of Education and Training needs to innovate the way of the second language teaching by applying the communicative approach in teachin...

Ngày tải lên: 07/09/2013, 13:02

77 893 5
iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

... devices and auxiliary circuits 4 .10 Rated pressure of compressed gas supply for operation i 4 .10 1 Rated filling pressure (of gas-filled compartments) 19 19 19 19 19 21 212 1 21 21 21 21 Definitions ... No (19 84) Amendment (19 94) 2: switches for rated voltages of 265-2 (19 88) Part High-voltage 52 kV and above Amendment (19 94) 298 A.C (19 90) metal-encled s...

Ngày tải lên: 25/12/2013, 10:57

139 465 0
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy

... Department at MSA - Nature of group work - Relationship between group work and individual presentation Objectives of the study  contribute more theory to the understandings of group discussion  find ... Number of participants in a group:  Number of groups: ( No planning groups & Pre-planning groups)  Records: All the group discussions and the indiv...

Ngày tải lên: 29/01/2014, 10:33

15 800 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Đề tài " Integrality of a ratio of Petersson norms and level-lowering congruences " pot

Đề tài " Integrality of a ratio of Petersson norms and level-lowering congruences " pot

... Annals of Mathematics, 163 (2006), 901–967 Integrality of a ratio of Petersson norms and level-lowering congruences By Kartik Prasanna To Bidisha and Ananya Abstract We prove integrality of ... KARTIK PRASANNA Tata Institute and IIT Bombay who guided me in my initial steps: especially Nitin Nitsure, M S Raghunathan, A R Shastri, Balwant Singh, V Srinivas and...

Ngày tải lên: 06/03/2014, 08:21

68 410 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

... exonuclease activity and invades the homologous doublestranded region of the other allele These steps of homology search and recombination are catalysed by two bacterial RecA homologues, Rad51 and Lim15/Dmc1 ... et al C D B Fig Molecular cloning of CcCac1L and its interaction with CcLim15 (A) Schematic diagram of the CAF-1 large subunits in human, C cinerea...

Ngày tải lên: 07/03/2014, 05:20

10 487 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... indicate the a- F1-ATPase GAF/ Adf-1 binding cassette has enhancer properties (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/ Adf-1 binding cassette is ... this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic subunits have been often used as markers for mitochondrial biogenesis...

Ngày tải lên: 07/03/2014, 16:20

11 532 0
Vật lý A level:AQA PHYA4 1 QP JUN12

Vật lý A level:AQA PHYA4 1 QP JUN12

... a radius of 1. 5 × 10 8 km What is the Earth’s approximate speed? A B 5.0 × 10 3 m s 1 C 1. 0 × 10 4 m s 1 D 1. 5 × 10 3 m s 1 3.0 × 10 4 m s 1 A particle moves in a circular path at constant speed Which ... at P A 10 00 μF capacitor and a 10 μF capacitor are charged so that they store the same energy The pd across the 10 00 μF capacitor is V1 and the pd across the...

Ngày tải lên: 12/03/2014, 16:00

12 691 0
Vật lý A level: AQA PHYA4 1 w QP JAN10

Vật lý A level: AQA PHYA4 1 w QP JAN10

... conserved WMP /Jan10 /PHYA4/ 1 What is the angular speed of a point on the Earth’s equator? A B C D 7.3 × 10 –5 rad s 1 4.2 × 10 –3 rad s 1 2.6 × 10 1 rad s 1 15 rad s 1 Which one of the following does ... END OF QUESTIONS WMP /Jan10 /PHYA4/ 1 10 There are no questions printed on this page WMP /Jan10 /PHYA4/ 1 11 There are no questions printed on this page WMP /Jan10 /P...

Ngày tải lên: 12/03/2014, 16:00

12 523 0
Vật lý A level: AQA PHYA5 1 QP JUN12

Vật lý A level: AQA PHYA5 1 QP JUN12

... rock sample at time t was 2.0 × 10 22 92 (1 mark) (c) (iii) Calculate t in years answer = years (3 marks) 10 Turn over (05) ᮣ WMP /Jun12 /PHYA5/ 1 Do not write outside the box (a) In a radioactivity ... (10 ) WMP /Jun12 /PHYA5/ 1 Do not write outside the box 11 (6 marks) END OF SECTION A 11 (11 ) WMP /Jun12 /PHYA5/ 1 12 There are ... through the heater at a rate of 0 .1...

Ngày tải lên: 12/03/2014, 16:14

12 460 0
w