a bidirectional link between mind and motion
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship Trends Biochem Sci 26, 131–136 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K ... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG...
- 10
- 487
- 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"
... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... on an ELISA analyzer (Tecan Genios, Salzburg, Austria) with the use of commercially available ELISA kits (Diagnostic Systems Laboratories, Inc Webster, Texas, USA), according to the manufacture’s ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric...
- 7
- 338
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
lei - determinants of cg and the link between cg and performance - evidence from the uk using a corporate governance scorecard
... 70.00 69.00 69.00 69.00 69.00 n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a n .a 82.00 81.00 77.00 73.00 73.00 ... et al (2003), Marry and Stangeland (2003), Klapper and Love (2004), and Bauer et al (2003) examine the impact of the governance standards on firm performance approximated by profitability ratios ... generally find a positive relationship between governance standards and firm value Baure et al (2003) and other studies are based on ratings of one or two years only, assuming that governance ratings...
- 100
- 321
- 0
A further analysis of the causal link between abortion and crime
... to have reached a lower plateau This is almost exactly 20 years after abortion rates themselves reached a sort of steady state 30 , and 20 years was Donohue and Levitt’s estimated lag for abortion ... Incomeper variables are unemployment rate and state per capita indexed by state and year The other terms are state and year fixed effects, and the error term The model is estimated with data from ... plateau in the early 1980s; at approximately the same time, total AFDC aid reached a low in real spending 33 , and maintained a lower rate for several years This is not to suggest that the rapid...
- 38
- 368
- 0
A Poisson bridge between fractional Brownian motion and stable Levy motion
... regarded as a “bridge” between fractional Brownian motion and stable L´evy motion and exhibits an intrinsic duality in its features 4.1 Locally and globally asymptotically self-similar processes A stochastic ... INRIA Available at http://www-syntim.inria.fr/fractales/ Pipiras, V and Taqqu, M S (2000) The limit of a renewal reward process with heavy-tailed rewards is not a linear fractional stable motion ... to a compensated Poisson random measure We start by recalling some facts about Poisson random measures 2.1 Poisson random measures and integrals A recent comprehensive account on Poisson random...
- 17
- 406
- 0
Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx
... important role of androgens in vascular health and erectile function Summary and conclusions Visceral obesity, in particular, is characterized by increased inflammatory factors, decreased plasma TT ... replacement and its pharmacogenetics on physical performance and metabolism Asian J Androl 10, 364–372 112 Yassin AA, Saad F & Traish A (2006) Testosterone undecanoate restores erectile function in a subset ... regarding this pathophysiological state Central (abdominal) obesity, as assessed by several characteristics including BMI, WC and WHR, is considered as a hallmark of the MetS and is associated...
- 13
- 662
- 0
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... just 30% of the target data to the source data achieved the same performance as that obtained by taking the entire source and target data Agirre and de Lacalle (2009) reported a 22% error reduction ... Comparing random strategy with oracle based ideal strategy for SemCor to Health adaptation Figure 6: Comparing random strategy with oracle based ideal strategy for SemCor to Tourism adaptation ... Research in Computational Linguistics, pages 19–33 Mitesh Khapra, Sapan Shah, Piyush Kedia, and Pushpak Bhattacharyya 2010 Domain-specific word sense disambiguation combining corpus based and...
- 10
- 337
- 1
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf
... from Mandarin than other regions in Mainland China One can easily spot Cantonese dialect articles in Hong Kong newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles ... J., Tomita M and Goodman K (1992) Machine Translation: A Knowledge-Based Approach Morgan Kaufmann Publishers, San Mateo, California, USA Sinclair J (1991) Corpus, Concordance and Collocation Collins, ... Design and Implementation A rudimentary design of a Cantonese-Mandarin dialect MT system has been made, as shown in Figure The system takes Cantonese Pinyin sentences as input and generates Mandarin...
- 5
- 438
- 0
taking shape - a new contract between architecture and nature
... humankind’s expulsion from the Garden Woman was blamed for the Fall, the fall of nature as much as of ‘man’, as what was once gentle and immortal became hostile and ultimately fatal We die, and ... ‘sustainable’ makes the term ‘sustainable architecture’ equally vague and ambiguous There are, after all, many forms of sustainability – economic, political and social, as well as environmental ... to Hyde Park as nature We say certain acts are not ‘natural’, and speak authoritatively about what ‘nature intended’ Ecologists describe an empirically measured nature, and poets and explorers...
- 236
- 485
- 0
Báo cáo y học: "a diagnostic dilemma between psychosis and post-traumatic stress disorder: a case report and review of the literature" ppsx
... reactive She described vivid and clear auditory and visual hallucinations and persecutory delusions Her medical psychiatric, personal, and family histories were unremarkable A physical examination, ... images of the traumatic event, with a markedly diminished interest and participation in significant activities and the avoidance of thoughts and conversations associated with the trauma She also ... Statistical Manual of Mental Disorders edition Washington, DC: APA; 1994 Kilcommons AM, Morrison AP: Relationships between trauma and psychosis: an exploration of cognitive and dissociative factors Acta...
- 5
- 407
- 0
Báo cáo y học: " Is neutrophil elastase the missing link between emphysema and fibrosis? Evidence from two mouse models" pps
... pulmonary disease Edited by: Voelkel NF, MacNee W Hamilton, Ontario, Canada: BC Decker Inc; 2002:237-256 Nagai A, Aoshiba K, Ishihara Y, Inano H, Sakamoto K, Yamaguchi E, Kagawa J, Takizawa T: Administration ... data GL conceived and coordinated the study, participated in the design of the study, analysis and interpretation of data and drafting the manuscript All authors read and approved the final manuscript ... was defined as: "inflammatory and mesenchymal cell infiltration within the alveolar septa and alveolar spaces with deposition of extracellular matrix", and emphysematous changes were defined as:...
- 14
- 279
- 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot
... 5'-TGTTTGGAGACTGTGTACAAGGCG-3', hTERT sense, 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3' ... TRF1 sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions ... progression of adult T-cell leukemia Leuk Res 1999, 23:311-316 Kubuki Y, Suzuki M, Sasaki H, Toyama T, Yamashita K, Maeda K, Ido A, Matsuoka H, Okayama A, Nakanishi T, et al.: Telomerase activity and telomere...
- 10
- 281
- 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
... virus replication At regular intervals, cells and filtered supernatant were stored at -80°C and virus was quantitated by CA-p24 ELISA When a revertant virus was identified, DNA was extracted from ... study JPM participated in the study design and coordination BB supervised the study, and participated in its design and coordination All authors read and approved the final manuscript Acknowledgments ... the text) was passaged onto × 106 fresh MT-2 T cells in the presence or absence of 0.3 mM BME and virus spread was measured for 10 days the rate of appearance of syncytia and CA-p24 antigen production...
- 11
- 393
- 0
Is the link between output and jobs broken
... Europe Asia and Pacific Canada Latin America and Other Western Hemisphere Middle East 1988 Broad Africa Source: BEA 1983 Major Currencies Strategic Analysis, March 2013 Other Important Trading Partners ... scale) External Balance (left scale) Real GDP Growth (right scale) Sources: BEA; authors’ calculations Strategic Analysis, March 2013 Sources: BEA; authors’ calculations -10 Annual Growth Rate ... case—that is, the negative of the private sector balance, the government deficit, and the current account balance—are illustrated in Figure These three balances are central to our approach and are linked...
- 16
- 226
- 0
WORKING PAPER SERIES NO. 548 / NOVEMBER 2005: THE LINK BETWEEN INTEREST RATES AND EXCHANGE RATES DO CONTRACTIONARY DEPRECIATIONS MAKE A DIFFERENCE? doc
... Australia is classi…ed as freely ‡ oating since December 1983 and as having a managed ‡ oat since 1974, and New Zealand is de…ned as having a managed ‡ oat since 1985 and a de facto moving band around ... can adopt any real value The value of is negative in a contractionary depreciation and positive in an expansionary depreciation All shocks are of the zero-mean, constant variance, type, and are ... (2005), Mohanty and Klau (2004) and Cavoli and Rajan (200 5a) , this e¤ect could be interpreted as an overall negative e¤ect of weaker real exchange rates on output in the aggregate demand schedule...
- 55
- 444
- 0
báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot
... possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism Gehan A Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and Treatment ... males and 15 females Their ages ranged between and 12 years (mean ± SD = 8.10 ± 2.52 years) Exclusions criteria: 1- Patients who had associated neurological diseases (such as cerebral palsy and ... were analyzed by commercially available software package (Statview, Abacus concepts, inc., Berkley, CA, USA) The data were non-parametric, thus they were presented as median and interquartile range...
- 30
- 522
- 0
Báo cáo y học: "Citrullination, a possible functional link between susceptibility genes and rheumatoid arthritis" ppsx
... Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima ... death and, in particular, during apoptosis (for an overview see [15]) B Correlation between RA and certain human leukocyte antigen haplotypes (e.g HLA-DR4 [HLA-DRB1*0401 and HLA-DRB1*0404]) has ... 23 PADI4, encoding citrullinating enzyme peptidylarginine deiminase 4, are associated with rheumatoid arthritis Nat Genet 2003, 34:395-402 Nakashima K, Hagiwara T, Yamada M: Nuclear localization...
- 5
- 381
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008