... configuration, issue the clear ip bgp * command on ISP1A Wait several seconds, and then use the show ip bgp command to view ISP1A’s BGP table Both paths should again be present in the table, but the best ... always-compare -med Issue the clear ip bgp * command on SanJose3, wait several seconds, and then check SanJose3’s BGP table with the command show ip bgp SanJose3 should h...
Ngày tải lên: 18/01/2014, 05:20
... Note: Make sure that the screensaver and any other programs that automatically start are temporarily disabled or they can interrupt the defragmenting process Troubleshooting If Scandisk reports a ... resolve the problem There is an option to convert recovered data to a text file However, this will clutter the drive with many text files of garbled information Select the option to...
Ngày tải lên: 24/01/2014, 19:20
Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx
... Journal of the American Academy of Child and Adolescent Psychiatry 1995, 34:1386-1405 Randall R, Parker J: Post-traumatic stress disorder and children of school age Educational Psychology in Practice ... African Journal of Child and Adolescent Mental Health 2000, 12:38-44 American Academy of Child and Adolescent Psychiatry: Practice parameters for the psychia...
Ngày tải lên: 08/08/2014, 21:20
báo cáo khoa học: " Improving quality of care through routine, successful implementation of evidence-based practice at the bedside: an organizational case study protocol using the Pettigrew and Whipp model of strategic change" potx
... overall the model focuses researchers and managers on the WHY of strategic change with relevance to context; the WHAT of strategic change in terms of its content; and the HOW of strategic change ... How and which implementation and other change strategies are used to achieve change at both the individual team and organizational levels relative to suc...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo y học: "Biochip sensors for the rapid and sensitive detection of viral disease" pps
... the speed of the engineered B cells This may take the form of microarrays constructed by arraying a panel of engineered cells, for instance, or even synthetic biomimetic systems Alternatively, ... only to detection and identification but also to the monitoring of viral populations In 1999, we and colleagues [6] described the first viral DNA microarray for the...
Ngày tải lên: 14/08/2014, 14:21
Tài liệu Overview of the Urological and Gynecological Devices Market doc
... Estimates Overview of Urological and Gynecological Devices Market p.8 ($ in millions) Market Cap $82 $120 Section Profiles of Select Participants in Urological and Gynecological Devices Market Company ... Note: Market Cap and Enterprise Value as of 12/29/2008 Thomson Consensus Estimates Overview of Urological and Gynecological Devices Market p.1...
Ngày tải lên: 13/02/2014, 06:20
Báo cáo " Development of climate change scenarios for small areas in Vietnam by using the MAGICC/SCENGEN software in combination with statistic correction" docx
... tool for nations to regions in terms of developing climate change scenarios Developing climate change scenarios for small areas of Vietnam Based on software MAGICC / SCENGEN, we have built climate ... form of decades of the 21st century However, within the scope of this paper, we only introduce climate change scenarios that are summarized in...
Ngày tải lên: 05/03/2014, 16:20
báo cáo hóa học:"Detecting exacerbations using the Clinical COPD Questionnaire" docx
... compliance and understanding of the daily assessments In addition, the Clinical COPD Questionnaire (CCQ) [19] was integrated in the diary card and assessed weekly The CCQ is a self-administered ... week-interval the CCQ change (Δ-CCQ-score) is calculated by subtracting the CCQ score of the ‘present’ Page of week from the CCQ score of the previous week Differences in CCQ...
Ngày tải lên: 20/06/2014, 16:20
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian L...
Ngày tải lên: 15/05/2015, 00:37
Natural botanical products have a long history in the world and are featured in using a complex
... Int J Med Sci 2004 1(3): 137-145 138 Introduction Natural botanical products have a long history in the world and are featured in using a complex combination of herbs to treat various diseases ... daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume...
Ngày tải lên: 03/11/2012, 09:54
USING THE ANALYTIC HIERARCHY PROCESS APPROACH FOR ASSESSMENT OF THE STRENGTH OF UNIVERSITY-INDUSTRY-GRI COOPERATION IN VIETNAM
... identify the strength of the individual linkage by determining the relative importance of the linkage types The goal is at the top of the model 4.4.2 The Actors Like the AHP model formulated for overall ... involvement in the process of technological assessment The objective of this study is to apply the Analytic Hierarchy Process (AHP) for...
Ngày tải lên: 23/04/2013, 10:29
PREDICTION OF ATRAZINE FATE IN RIPARIAN BUFFER STRIPS SOILS USING THE ROOT ZONE WATER QUALITY MODEL
... in each window session RESULTS AND DISCUSSIONS Simulation of atrazine fate, leaching and runoff loss As atrazine load into the RBS and the runoff depth from the cornfield increased the atrazine ... only provides inputs to the rest of the model that there is a crop growing Simulation of atrazine transport The focus of this simulation was on the movement of...
Ngày tải lên: 05/09/2013, 09:08
Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon
... removal of arsenic from synthetic groundwater using sequential combination of LA and AC-Fe as adsorbents The effect of LA/AC-Fe ratio, flow rate, initial arsenic concentration and pH to the breakthrough ... (70%AsIII&30%AsV) CONCLUSION The removal of arsenic from synthetic groundwater by adsorption using LA and AC-Fe was investigated in this...
Ngày tải lên: 05/09/2013, 09:38