Photoimmunotherapy of melanoma via combination of hypericin photodynamic therapy and in vivo stimulation of dendritic cells by PNGVL3 HFLEX plasmid DNA
Photoimmunotherapy of melanoma via combination of hypericin photodynamic therapy and in vivo stimulation of dendritic cells by PNGVL3 HFLEX plasmid DNA
... KM, Bay BH, Soo KC Photoimmunotherapy of murine melanoma via combination of hypericinphotodynamic therapy and in vivo stimulation of dendritic cells by pNGVL 3hFlex plasmid DNA Submitted for publication ... melanoma via combination of hypericinphotodynamic therapy and in vivo stimulation of dendritic cells by pNGVL 3hFlex plasmid DNA Oral presentation at the 10th World Congress of the International Photodynamic ... combination of hypericin (HY)-PDT and in vivo stimulation of DCs via pNGVL3- hFlex plasmid DNA was investigated in murine B16 melanoma The anti-tumor effectiveness of PDT alone, photoimmunotherapy...
- 130
- 331
- 0
báo cáo hóa học: " Comparison of immature and mature bone marrow-derived dendritic cells by atomic force microscopy" potx
... http://www.nanoscalereslett.com/content/6/1/455 force between both immature and mature bone marrowderived dendritic cells (BMDCs) Obviously, this study would provide a novel insight into the nanostructure and force feature of immature and ... study of immature and immature BMDCs was carried out by AFM to Figure MHC-II expression and IL-12 production of immature and mature BMDCs (A-D) Flow cytometry was used to detect CD11c and MHC-II ... Xing et al.: Comparison of immature and mature bone marrow-derived dendritic cells by atomic force microscopy Nanoscale Research Letters 2011 6:455 Submit your manuscript to a journal and benefit...
- 9
- 469
- 0
Báo cáo khoa học: "Altered maturation of dendritic cells by taxol, an anticancer drug" ppt
... more MHC class II than immature DCs on their surface It is thus suggested that taxol may induce the maturation of DCs No change in the viability of DCs by taxol, an anticancer drug MTT assay ... were seeded and treated Cells were stained with annexin V-FITC/PI and analyzed by using flow cytometry An anticancer drug, mitomycin C was used as positive control for the apoptosis of DCs Result ... cell death of DCs Annexin V-FITC staining was performed to check if Fig The viability of DCs was not decreased by taxol, an anticancer drug DCs were harvested at 6-8 days after culture Cells were...
- 6
- 223
- 0
In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors insight into molecular mechanism and biologic characterization
... In vitro and In vivo study of ABT- 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors: insight into molecular mechanism and biologic characterization ... target of STAT3 3.3.9 In vivo efficacy of IDR E804 in combination with ABT- 869 for treatment of MV4-11-R mouse xenografts 69 Discussion 73 References 78 Chapter The combination of HDAC Inhibitors and ... CalcuSyn software for (A) simultaneous combination of ABT- 869 with Ara-C, (B) simultaneous combination of ABT- 869 and Dox , (C) pretreatment with ABT- 869 first followed by Ara-C, (D) pretreatment with...
- 121
- 368
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the ... B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted using...
- 7
- 391
- 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... translocation of PDK-1 and Akt activation in transfected HEK cells [14] On the other hand, the functional significance of the inter- Insulin-induced translocation of Grb14 in rat liver action of Grb14 ... residues of the IR kinase loop, which help position the PIR–BPS and increase binding affinity [8] Although the interaction of Grb14 with the IR is probably the major determinant of the insulin-induced ... assessed the ability of insulin administered in vivo to increase the level of RCAM-lysozyme in cell fractions, and then assayed the fractions of insulin-injected rats for Grb14, IR and phosphorylated...
- 15
- 497
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...
- 12
- 588
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
- 9
- 422
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot
... et al (2005) A microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi ... this approach discriminates normal and neoplastic tissues in various cancer types, including CLL, breast cancer, glioblastoma, thyroid papillary carcinoma, hepatocellular carcinoma, lung cancer, ... minireview was to provide, in overview, a summary of the potential application of miRNAs as diagnostic and therapeutic targets in cancer TranslaƟonal repression Fig miRNA generation and gene regulation...
- 8
- 432
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach of miRNA generation and its activity ... monitoring the therapeutic potential of miRNAs in cancer Bioimaging of microRNA biogenesis The molecular mechanisms involved in miRNA generation are complex, and at least several processing steps in ... measuring the decrease of optical signal in vivo [34] Also, miRNA21 is a potential therapeutic 2170 target for cancer treatment, as overexpression of antimiRNA21 in hepatocellular carcinoma and...
- 10
- 463
- 0
Báo cáo Y học: Growth inhibition of mammalian cells by eosinophil cationic protein pptx
... induced by the eosinophil cationic protein and eosinophil protein X J Allergy Clin Immunol 70, 361±366 Motojima, S., Frigas, E., Loegering, D.A & Gleich, G.J (1989) Toxicity of eosinophil cationic proteins ... effect of growth inhibition may be replicated by other polycations To investigate this, we checked the effect of poly(L-lysine), which has a cationic charge that is almost equivalent to that of ECP ... absence of 10 lM ECP or RNase A and analyzed by a ¯ow cytometer The area of dead cells is shaded Peaks I and II show the population of cells in G1/G0 and G2/M phase, respectively supplemented by the...
- 10
- 423
- 0
Báo cáo khoa học: Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions docx
... 271) strain 80204-1 produced under in vitro growth conditions on tryptic soy agar (TSA) and in vivo and have demonstrated that their structures are chemically and antigenically distinct from the ... TOF Analysis of the in vivo cultured A salmonicida strain 80204-1 cells In vivo culture was performed using ligated dialysis tubing bags filled with bacterial suspension of A salmonicida strain ... sample of A salmonicida (data not shown) The proposed structure of CPS and O-chain polysaccharide of A salmonicida strain 80204-1 is depicted in Fig The biological significance of these findings...
- 10
- 332
- 0
Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot
... collected and analyzed by SDS/PAGE In vitro self-cleavage of S pneumoniae SPase I For in vitro self-cleavage of S pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing lg of ... dramatic decrease of the enzymatic activity, implying that the self-cleavage, if occurring in vivo, may play an important role in the regulation of the enzymatic activity within the cells Interestingly, ... reaction that inactivates the protein The self-cleavage of LexA protein is important in the SOS response in bacteria [21–23] In vitro self-cleavage was also observed in all investigated bacterial...
- 9
- 351
- 0
Báo cáo khóa học: Determination of modulation of ligand properties of synthetic complex-type biantennary N-glycans by introduction of bisecting GlcNAc in silico, in vitro and in vivo pot
... question of whether introduction of the bisecting GlcNAc changes the ligand properties (binding affinities) of biantennary N-glycans for branch-end-specific lectins as well as for cells and organs ... [37] N-glycans [37] in Table The general conclusion is that the presence of a bisecting GlcNAc affects lectin affinity In the case of mistletoe lectin, the introduction of a bisecting GlcNAc into ... signal of binding of the fluorescent probe is given as extent of carbohydrate -ligand- dependent binding by subtracting carbohydrate-independent binding from total binding for each cell line BiB10-BSA...
- 17
- 481
- 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
... Figure Cytotoxicity assay Cytotoxicity assay Multiple AAV vectors for DC loading and the autologous targets generated using the IE1 subgenes Targets were generated by viral loading of the IE1 ... Generation of cytomegalovirus- specific human Tlymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine specificity of the ... different doses of AAV/IE1 vector were used for DC loading and a zero virus control (PBMC only) The cytotoxicity of the stimulated T-cells directly correlated with the amount of AAV/IE1 used to load...
- 8
- 451
- 0
Từ khóa: history of english literature by edward albert pdf downloadhistory of english literature by edward albert free downloadthe adventures of tom sawyer by mark twain pdf downloadfundamentals of electric circuits by alexander pdf free downloadthe adventures of sherlock holmes by sir arthur conan doyle epubprinciples of marketing book by philip kotler free downloadstimulation of hair cells by membrane deformationindirect bystander activation of inkt cells by gram negative lps positive bacteriatechniques for assessment of interactions of mucins with microbes and parasites in vitro and in vivoresearch studies of qigong therapy for cancer for the past 20 years in china were reviewed from three different categories clinical study on human cancer patients in vitro study of cancer cells and in vivo study of cancer with qigong therapregulation of apoptosis invasion and angiogenesis of tumor cells by caffeic acid phenethyl estepurification of viral particles by cesium chloride cscl density centrifugationisolation differentiation and characterisation of skeletal stem cells from human bone marrow in vitro and in vivoapos apos 8p specific apos apos microarrays two novel metastatic suppressors were identified and proved to suppress in vitro invasion and in vivo metastasis of hcc4 postimplantation remodeling and in vivo recruitment of microvascular networksNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ