Photoimmunotherapy of melanoma via combination of hypericin photodynamic therapy and in vivo stimulation of dendritic cells by PNGVL3 HFLEX plasmid DNA

... KM, Bay BH, Soo KC Photoimmunotherapy of murine melanoma via combination of hypericinphotodynamic therapy and in vivo stimulation of dendritic cells by pNGVL 3hFlex plasmid DNA Submitted for publication ... melanoma via combination of hypericinphotodynamic therapy and in vivo stimulation of dendritic cells by pNGVL 3hFlex plasmid...

Ngày tải lên: 28/11/2015, 13:45

... http://www.nanoscalereslett.com/content/6/1/455 force between both immature and mature bone marrowderived dendritic cells (BMDCs) Obviously, this study would provide a novel insight into the nanostructure and force feature of immature and ... study of immature and immature BMDCs was carried out by AFM to Figure MHC-II expression and IL-12 production of i...

Ngày tải lên: 21/06/2014, 02:20

... more MHC class II than immature DCs on their surface It is thus suggested that taxol may induce the maturation of DCs No change in the viability of DCs by taxol, an anticancer drug MTT assay ... were seeded and treated Cells were stained with annexin V-FITC/PI and analyzed by using flow cytometry An anticancer drug, mitomycin C was used as positive control for the apopto...

Ngày tải lên: 07/08/2014, 17:22

... In vitro and In vivo study of ABT- 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors: insight into molecular mechanism and biologic characterization ... target of STAT3 3.3.9 In vivo efficacy of IDR E804 in combination with ABT- 869 for treatment of MV4-1...

Ngày tải lên: 11/09/2015, 09:06

... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically...

Ngày tải lên: 23/04/2013, 21:38

... translocation of PDK-1 and Akt activation in transfected HEK cells [14] On the other hand, the functional significance of the inter- Insulin-induced translocation of Grb14 in rat liver action of Grb14 ... residues of the IR kinase loop, which help position the PIR–BPS and increase binding affinity [8] Although the interaction of Grb14 with the I...

Ngày tải lên: 18/02/2014, 18:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAA...

Ngày tải lên: 07/03/2014, 21:20

... et al (2005) A microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi ... this approach discriminates normal and neoplastic tissues in various cancer types, including CLL, breast cancer, glioblastoma, thyroid papillary carcinoma, hepatocellular carcinom...

Ngày tải lên: 16/03/2014, 01:20

... stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach of miRNA generation and its activity ... monitoring the therapeutic potential of miRNAs in cancer Bioimaging of microRNA biogenesis The molecular mechanisms involved in miRNA generation are complex,...

Ngày tải lên: 16/03/2014, 01:20

... induced by the eosinophil cationic protein and eosinophil protein X J Allergy Clin Immunol 70, 361±366 Motojima, S., Frigas, E., Loegering, D.A & Gleich, G.J (1989) Toxicity of eosinophil cationic proteins ... effect of growth inhibition may be replicated by other polycations To investigate this, we checked the effect of poly(L-lysine), which has a cationic charg...

Ngày tải lên: 17/03/2014, 17:20

... 271) strain 80204-1 produced under in vitro growth conditions on tryptic soy agar (TSA) and in vivo and have demonstrated that their structures are chemically and antigenically distinct from the ... TOF Analysis of the in vivo cultured A salmonicida strain 80204-1 cells In vivo culture was performed using ligated dialysis tubing bags filled with ba...

Ngày tải lên: 23/03/2014, 13:20

... collected and analyzed by SDS/PAGE In vitro self-cleavage of S pneumoniae SPase I For in vitro self-cleavage of S pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing lg of ... dramatic decrease of the enzymatic activity, implying that the self-cleavage, if occurring in vivo, may play an important role in the regulation of...

Ngày tải lên: 23/03/2014, 21:21

... question of whether introduction of the bisecting GlcNAc changes the ligand properties (binding affinities) of biantennary N-glycans for branch-end-specific lectins as well as for cells and organs ... [37] N-glycans [37] in Table The general conclusion is that the presence of a bisecting GlcNAc affects lectin affinity In the case of mistletoe lectin, the intr...

Ngày tải lên: 30/03/2014, 13:20

... Figure Cytotoxicity assay Cytotoxicity assay Multiple AAV vectors for DC loading and the autologous targets generated using the IE1 subgenes Targets were generated by viral loading of the IE1 ... Generation of cytomegalovirus- specific human Tlymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine s...

Ngày tải lên: 18/06/2014, 15:20