Isolation, cloning and expression of NAD+ glycohydrolase from neurospora crassa

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...

Ngày tải lên: 12/02/2014, 10:20

... 5¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ 5¢-CCATCACAAGAAACTAGAGAAAC-3 5¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ 5¢-CGAGCTCACTGCCTCTCAAC-3¢ 5¢-ACTCGTAGC-ACAGAGACAGAG-3¢ 5¢-ATGGCAGTAGTAGCAG-CTCC-3¢ 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ ... Remarks 10 11 12 13 5¢-GG (A ⁄ T)CA (A ⁄ C)GG (A ⁄ T)AC (A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ 5¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ 5...

Ngày tải lên: 19/02/2014, 07:20

... activity of the purified chicken liver ecto-ATPDase is  30% of the MgATPase activity at a divalent ion-ATP concentration of mM at pH 7.4 On the other hand, the CaADPase activity is  80% of the ... activated by the same detergents and are extracted from the membranes by high concentrations of NP-40 [7,23] (and this study) This study shows unambiguously that the...

Ngày tải lên: 22/02/2014, 04:20

... genes involved in host defence against bacterial infection in rainbow trout (Oncorhynchus mykiss) , the gene -expression profile of bacterial-challenged rainbow trout was surveyed by means of suppression ... player in the cytokine network and the host immune response to infection in fish Experimental procedures Cell lines and cell culture Four rainbow trout...

Ngày tải lên: 07/03/2014, 16:20

... Tyr158, Glu2 12, Arg215 and Trp246 in ricin) and another ve conserved residues (Asn 72, Arg 124 , Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln1 72, Glu208 and Asn209 in ricin) ... Journal 27 2 (20 05) 120 1 121 0 ê 20 05 FEBS 120 3 Pulchellin A- chain: cloning and structural studies A A L C Silva et al B C Fig (A) A- chain expression anal...

Ngày tải lên: 07/03/2014, 16:20

... localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER Determination of D14-SR activity To demonstrate that the cloned bovine liver ... presence of signature patterns conserved from yeast D14-SR (ERG24 gene) and sterol D24(28)-reductase (ERG4 gene), as well as the degree of similarity with human LBR...

Ngày tải lên: 08/03/2014, 16:20

... glabra GgbAS1 b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ... Ebizuka, Y (2001) Cloning and characterization of a cDNA encoding b-amyrin synthase involved in glycyrrhizin and soyasaponin biosynthesis in licorice Biol Phar...

Ngày tải lên: 08/03/2014, 23:20

... Full-length cDNA for expression was cloned by another RT-PCR with primers fullMJEforMQ (GCATGCAGGGTGATAAAAA TCACTTTGTA) and fullMJErev (AAGGATCCATAA TATTTTTGCGAAATC), adding restriction sites for SphI and ... of tomato Proc Natl Acad Sci USA 99, 6416–6421 17 Meyer, R., Rautenbach, G.F & Dubery, I .A (2003) Identification and quantification of methyl jasmonate in leaf volati...

Ngày tải lên: 16/03/2014, 18:20

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

... isolated and sequenced two full-length cDNAs from D purpurea leaves that encode DpAR1 and DpAR2, two new members of the AKR superfamily; specifically, the amino-acid sequences of DpARs show relatively ... the cloning and expression of two AKR genes from D purpurea Both proteins reduce the ketone group of steroid structures but they are not active on the D4-dou...

Ngày tải lên: 18/03/2014, 01:20

... of the expression of the enzymes involved in the salvage pathway of GDP-L-fucose indicates that not only the de novo pathway alone, but also the salvage pathway could have an essential role in ... and the corresponding gene has been cloned from human [23] In the present study we have cloned the murine genes coding for the enzymes involved...

Ngày tải lên: 30/03/2014, 13:20

... flavonol-O-glucosyltransferases from Fragaria × ananassa (AAU09444) and (ABB92748); NtGT 1a and NtGT1b, broad substrate specificity glucosyltransferases from Nicotiana tabacum (BAB60720) and (BAB60721); ... Ubukata T, Hayashida N, Yamamoto H, Okazaki M: Cloning and characterization of a glucosyltransferase that reacts on 7-hydroxyl group of flavonol and 3-hydroxyl g...

Ngày tải lên: 12/08/2014, 03:21

... Optimization of the PfMCA1 gene sequence for yeast expression The original PfMCA1 gene sequence, the optimized PfMCA1 gene, and the PfMCA1 amino acid sequence are shown in black, green and blue respectively ... attached at the C-terminus of the cloned gene Cloning was achieved by having the NheI restriction site and BamHI restriction site at the 5’...

Ngày tải lên: 03/10/2015, 20:57

... the mechanism of transcriptional regulation of the FSH subunit gene promoter of the Chinook salmon The Chinook salmon FSH subunit gene and 5’ flanking sequence will be isolated, sequenced and ... regard to the size of introns and 3’ untranslated region (3’ UTR; Figure 3) Compared to the 0.3 – 0.35 kb size of intron of the LHβ genes, the size...

Ngày tải lên: 08/11/2015, 17:15

... Check 77 3.9 NAD+ Cycling Assay 81 Discussions 4.1 Isolation and Characterization of Conidial NADase from N crassa 83 4.2 Identification of NADase Sequence 85 4.3 Cloning and Expression of Gi|85106032 ... Tables vii List of Figures viii Abbreviations x Introduction 1.1 Overview of NAD+ Metabolism and NAD+ Glycohydrolase 1.1.1 Mammalian NADase 1.1.2 Neurospora...

Ngày tải lên: 08/11/2015, 17:15