MAGNETIC FIELD DEPENDENCE OF MAGNETIC CASIMIR EFFECT

... Purification and refolding of N-terminal His-tagged gAd-GLP-1-A fusion protein The fusion protein was purified by High-Affinity Ni-IDA Resin After filtering, the fusion protein was bound in the column ... by improving both insulin resistance and insulin secretion deficiency However, we only observed the glucose-lowering effect of the whole fusion protein in thi...

Ngày tải lên: 25/10/2012, 11:10

... investigate the effect of Ca and Mg addition on the leaching behavior of As from highly contaminated paddy field soil under different concentrations of Ca and Mg addition, pH conditions and anaerobic ... Other Conditions 0.9 Effect of P and 100 and 2.0 pH adjusted to 3.0, 5.0, 7.0, 9.0 and 11.0 pH 7.0 Leaching in anaerobic incubation and 100 0.9 Eff...

Ngày tải lên: 05/09/2013, 10:15

Ngày tải lên: 12/01/2014, 22:06

... TWh Office equipment energy consumption has since grown to 74 TWh3 (Kawamoto et al., 2001) This growth has drawn attention to the office equipment end use As the energy impacts of office equipment ... non-business hours is an important determinant of energy use In a 9to-5 office, office equipment is used during less than 25 percent of the week For personal office equ...

Ngày tải lên: 18/02/2014, 04:20

... An Aviator's Field Book, by Oswald Bölcke Being the Field Reports of Oswald Bölcke, from August 1, 1914, to October 28, 1916 TRANSLATED FROM THE GERMAN BY ROBERT REYNOLD ... learned An Aviator's Field Book, by Oswald Bölcke 17 further details from Lieutenant B After landing, one of the aviators ran to the village, returned with a stretc...

Ngày tải lên: 18/02/2014, 09:20

... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The e...

Ngày tải lên: 19/02/2014, 05:20

... to avoid the formation of hairpin or slipped duplex structures and to limit the base pair length less than 12 bp For any of the non-self-complementary duplex formations, the thermodynamic parameters ... DNA/DNA and 41 RNA/DNA duplexes at standard temperature (25 C) and physiological temperature (37 C) Direct comparison shows that the temperature- independent and...

Ngày tải lên: 22/02/2014, 07:20

... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction o...

Ngày tải lên: 07/03/2014, 06:20

... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved...

Ngày tải lên: 07/03/2014, 09:20

... a t is, if the training and test sets are extracted from the same corpus, they will probably contain the same kind of errors in the same kind of situations This may cause the training procedure ... uncertainty in the evaluation m a y be, in some cases, larger than the reported improvements from one system to another, so invalidating the conclusions of the co...

Ngày tải lên: 08/03/2014, 05:21

... the temperature dependence of the morphology of SiNWs synthesized by laser ablation In this Letter, we present the results on this project Our results show that the morphology and diameter of ... B, the temperature dependence of the morphology and diameter of the SiNWs is similar to that by thermal evaporation, reported recently by Peng et al [14] I...

Ngày tải lên: 16/03/2014, 15:09

... presence of a small external field For the ZFC data, the magnetic moment rises more rapidly and attains a greater maximum value for the field applied parallel to the film surface This implies an easy magnetization ... qualitative agreement with the theoretical model of the ZFC magnetization of weakly interacting nanoparticle assemblies proposed by Azeggagh and Kachkachi [31...

Ngày tải lên: 21/06/2014, 17:20

... study the electron-spin dynamics in dependence of the orientation (h) of the magnetic field The spin precession frequency, amplitude, and decay rate as a function of h are estimated and their dependences ... electron spin and rapidly relaxing spin of the hole Since gk and g\ are close in magnitude, the contribution from a difference in the spread of thei...

Ngày tải lên: 22/06/2014, 00:20

... MANIFESTATIONS OF QUANTUM MECHANICS IN OPEN SYSTEMS: FROM OPTO -MECHANICS TO DYNAMICAL CASIMIR EFFECT GIOVANNI VACANTI (Master in physics, Universit´ degli studi ... [44] to avoided crossing in two level quantum systems [52] In this thesis, we pursue the intriguing task of studying a genuine manifestation of quantum mechanics such as DCE in the...

Ngày tải lên: 10/09/2015, 09:10

... precession in spin transport 24 1.3 Objective and scope of this thesis 25 1.3.1 Atomic number dependence on spin Hall effect 25 Experimental techniques 27 2.1 ... relaxation length with coherent spin transport up to hundreds of micron [2][3] In this thesis, we study the possibility of manipulating electron spins in graphene via spin Hall effect (SHE) through meta...

Ngày tải lên: 30/09/2015, 10:11